Difference between revisions of "Part:BBa J31001:Design"

Revision as of 19:47, 23 February 2007

DNA invertase Hin tagged with LVA

Hin Invertase

The Hin invertase enzyme from Salmonella typhimurium has been studied extensively in E. coli. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.
Figure 1. 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)
A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].	A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].	A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].

Design Notes

This part was cloned via PCR amplification of BBa_J31000 using the following primers. The reverse oligo was designed to add the LVA degredation tag to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
Forward: 5' TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.

Data

Inversion of HixC-flanked DNA in the presence of HinLVA HinLVA has been assembled with a pLac promoter and RBS (see BBa_S03536) to create a HinLVA expression casette. We observe inversion of HixC-flanked segments of DNA in the presence of this casette. Figure 2 shows the sizes of predicted NheI restriction fragments for different conformations of two HixC-flanked DNA segments. A construct carrying the pBad promoter in the forward orientation (BBa_S03564) yields a 200 bp fragment (Figure 3, lane 2), while the reverse orientation (BBa_S03565) yields a larger 300 bp fragment (Figure 3, lane 3). In the presence of the HinLVA expression casette, the construct carrying pBad in the forward orientation shows restriction fragments for both orientations (Figure 3, lane 4). Similar results are seen for a construct carrying a HixC-flanked RBS-Tet segment (BBa_J3103) (Figure 4). The occurrence of the forward and reverse orientations in roughly equal proportions suggests that inversion has reached a steady state. Inversion occurs without IPTG induction of pLac-Hin. This may be caused by Hin expression via read-through from the vector backbone or leaky transcription from pLac.
Figure 2. Predicted NheI fragments for different conformations of the different HixC-flanked DNA fragments tested (not drawn to scale).	Figure 3. An NheI digest detects Hin-mediated flipping of a HixC-flanked pBad promoter.	Figure 4. An NheI digest detects Hin-mediated flipping of a HixC-flanked coding region (RBS-Tet).

Source

Hin invertase (BBa_J31000) from Salmonella typhimurium and the LVA degradation tag (BBa_M0040).

References

• Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA. PNAS.
• Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs. Science. 309: 1210-1215
• Sanders, E.R., Johnson, R.C. (2004) Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution. J. Mol. Biol. 340: 753–766.
• Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks
• Yang, W., Steitz, T.A. (1995) Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site. Cell. 82:193-207
• Figure 3. The data in Figure 3 was generously provided by Todd Eckdahl (Missouri Western State University iGEM 2006 Team).