Difference between revisions of "Part:BBa K1110003"
Line 4: | Line 4: | ||
Codes for the peptide Mambalgin-1, an analgesic | Codes for the peptide Mambalgin-1, an analgesic | ||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba. Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes. | Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba. Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes. | ||
+ | <!-- Add more about the biology of this part here | ||
+ | |||
<!-- --> | <!-- --> |
Revision as of 00:00, 25 August 2015
Mambalgin-1 cDNA
Codes for the peptide Mambalgin-1, an analgesic
Usage and Biology
Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba. Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes. Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
CTGAAATGTTACCAACATGGTAAAGTTGTGACTTGTCATCGAGATATGAAGTTTTGCTATCATAACACTGGCATGCCTTTTCGAAATCTCAAGCTCATCCTACAGGGATGTTCTTCTTCGTGCAGTGAAACAGAAAACAATAAGTGTTGCTCAACAGACAGATGCAACAAA