Difference between revisions of "Part:BBa K1432001"

Revision as of 21:43, 2 November 2014

A Synthetic microcystin-degrading Mlr A gene

No part name specified with partinfo tag.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Sequence of Synthetic mlr A: No part name specified with partinfo tag.

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K1432001 short</partinfo>
-A Synthetic microcystin-degrading Mlr A gene from Sphingomonas sp. ACM-3962 which codon were optimized using Lactococcus lactis abundant codon
+<partinfo>A Synthetic microcystin-degrading Mlr A gene from Sphingomonas sp. ACM-3962 which codon were optimized using Lactococcus lactis abundant codon</partinfo>
 <!-- Add more about the biology of this part here
 ===Usage and Biology===
-MlrA is the only microcystin-degrading gene, which cut the Microcystin LR cycle structure to a line.
+<partinfo>MlrA is the only microcystin-degrading gene, which cut the Microcystin LR cycle structure to a line. </partinfo>
+<partinfo>MlrA is the most important enzyme for the microcystin metabolism mechanism because the cyclic structure promotes microcystin stability against other protease and chemical factors. As the mlrA gene has a very rare sequence and there are almost no homologous genes in the DNA database, we could not predict its origin or family. Since there are no other reports of an mlrA homologous gene, we have very limited genetic information on the biodegradation of microcystin .</partinfo>
+<partinfo>In 1994, Jones et.al. isolated a microcystin-degrading bacterium, MJPV,from Australian water bodies for the ¢rst time. The strain was identi¢ed as Sphingomonas sp. based on 16S rRNA gene sequence. Bourne et al. performed cloning and gene library screening of the Sphingomonas sp. strain and detected the microcystin-degrading gene cluster, mlrA,B, C and D. The enzyme encoded by the mlrA gene can cleave the ADDA^Arg peptide bond in microcystin LR and open the cyclic structure. After opening the cyclic structure, linear microcystin LR is degraded by the peptidases encoded by mlrB and mlrC, and divided into each amino acid. The mlrD encodes the transporter protein that allows the uptake of microcystins into the cell .</partinfo>
-MlrA is the most important enzyme for the microcystin metabolism mechanism because the cyclic structure promotes
-microcystin stability against other protease and chemical factors. As the mlrA gene has a very rare sequence and there are almost no homologous genes in the DNA database, we could not predict its origin or family. Since there are no other reports of an mlrA homologous gene, we have very limited genetic information on the biodegradation of microcystin .
-In 1994, Jones et.al. isolated a microcystin-degrading bacterium, MJPV,from Australian water bodies for the ¢rst time. The strain was identi¢ed as Sphingomonas sp. based on 16S rRNA gene sequence. Bourne et al. performed cloning and gene library screening of the Sphingomonas sp. strain and detected the microcystin-degrading gene cluster, mlrA,B, C and D. The enzyme encoded by the mlrA gene can cleave the ADDA^Arg peptide bond in microcystin LR and open the cyclic structure. After opening the cyclic structure, linear microcystin LR is degraded by the peptidases encoded by mlrB and mlrC, and divided into each amino acid. The mlrD encodes the transporter protein that allows the uptake of microcystins into the cell .
@@ Line 17: / Line 24: @@
 <partinfo>BBa_K1432001 SequenceAndFeatures</partinfo>
 Sequence of Synthetic mlr A:
-ATGCGAGAATTTGTTCGACAACGACCATTATTATGTTTTTATGTTTTAGCTATTTTAATTGCTTTAGCTGCTCATGCTTTACGAGCTATGTCACCAACTCCATTAGATCCAATGTTTAAAATGTTACAAGAAACTCATGCTCATTTAAATATTATTACTGCTGTTCGATCAACTTTTGAATATCCAGGAGCTTATACTTTATTATTATTTCCAGCTGCTCCAATGTTTGCTGCTTTAATTGCTACTGGAATTGGATATGGACAAGCTGGATTTCGAGAATTATTATCACGATGTGCTCCATGGCGATCACCAGTTTCATGGCGACAAGGAGTTACTGTTATTGCTGTTTGTTTTTTAGCTTTTTTTGCTTTAACTGGAATTATGTGGGTTCAAACTTATTTATATGCTCCACCAGGAACTTTAGATCGAACTTTTTTACGATATGGATCAGATCCAGTTGCTATTTATGTTATGTTAGCTGCTTCATTATTATTATCACCAGGACCATTATTAGAAGAATTAGGATGGCGAGGATTTGCTTTACCACAATTATTAAAAAAATTTGATCCATTAACTGCTGCTGTTATTTTAGGAATTATGTGGTGGGCTTGGCATTTACCACGAGATTTACCAACTTTATTTTCAGGAGCTCCAGGAGCTGCTTGGTCAGTTATTGTTAAACAATTAGTTATTACTCCAGGATTTATTGCTTCAACTATTATTGCTGTTTTTGTTTGTAATAAATTAGGAGGATCAATGTGGGGAGGAGTTTTAACTCATGCTATTCATAATGAATTAGGAGTTAATGTTACTGCTGAATGGGCTCCAACTGTTGCTGGATTAGGATGGCGACCATGGGATTTAATTGAATTTGCTGTTGCTATTGGATTAGTTTTAATTTGTGGACGATCATTAGGAGCTGCTTCACCAGATAATGCTCGATTAGCTTGGGGAAATGTTCCACCAAAATTACCAGGAGGAGTTGGAGATAAATCAGGAGCTAATGCTTAA
+<partinfo>ATGCGAGAATTTGTTCGACAACGACCATTATTATGTTTTTATGTTTTAGCTATTTTAATTGCTTTAGCTGCTCATGCTTTACGAGCTATGTCACCAACTCCATTAGATCCAATGTTTAAAATGTTACAAGAAACTCATGCTCATTTAAATATTATTACTGCTGTTCGATCAACTTTTGAATATCCAGGAGCTTATACTTTATTATTATTTCCAGCTGCTCCAATGTTTGCTGCTTTAATTGCTACTGGAATTGGATATGGACAAGCTGGATTTCGAGAATTATTATCACGATGTGCTCCATGGCGATCACCAGTTTCATGGCGACAAGGAGTTACTGTTATTGCTGTTTGTTTTTTAGCTTTTTTTGCTTTAACTGGAATTATGTGGGTTCAAACTTATTTATATGCTCCACCAGGAACTTTAGATCGAACTTTTTTACGATATGGATCAGATCCAGTTGCTATTTATGTTATGTTAGCTGCTTCATTATTATTATCACCAGGACCATTATTAGAAGAATTAGGATGGCGAGGATTTGCTTTACCACAATTATTAAAAAAATTTGATCCATTAACTGCTGCTGTTATTTTAGGAATTATGTGGTGGGCTTGGCATTTACCACGAGATTTACCAACTTTATTTTCAGGAGCTCCAGGAGCTGCTTGGTCAGTTATTGTTAAACAATTAGTTATTACTCCAGGATTTATTGCTTCAACTATTATTGCTGTTTTTGTTTGTAATAAATTAGGAGGATCAATGTGGGGAGGAGTTTTAACTCATGCTATTCATAATGAATTAGGAGTTAATGTTACTGCTGAATGGGCTCCAACTGTTGCTGGATTAGGATGGCGACCATGGGATTTAATTGAATTTGCTGTTGCTATTGGATTAGTTTTAATTTGTGGACGATCATTAGGAGCTGCTTCACCAGATAATGCTCGATTAGCTTGGGGAAATGTTCCACCAAAATTACCAGGAGGAGTTGGAGATAAATCAGGAGCTAATGCTTAA</partinfo>
 <!-- Uncomment this to enable Functional Parameter display