Latest revision as of 14:49, 18 October 2014

T7-RBS Intein-tag

This part is a vector built for intein tag mediated purifications of proteins.

Usage and Biology

Protein purification

Figure 1: Scheme for intein mediated purification

For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-tag mediated purification system. The disadvantage of this system is that the tag remains attached to the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification (BBa_K1465230).
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification of the natural untagged protein can be achieved. The chitin binding domain binds the column at which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows the cleavage of the attached intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column (Figure 1).
We implemented this system in the pSB1C3 backbone by combining the T7 promoter with RBS and intein tag with a chitin binding domain.

Figure 2: Scheme vor purification vector

By designing Gibson Assembly primers with flanking overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):
>GSP_fw
CTATAGGGAAAGAGGAGAAAT
>GSP_rev
CTAGTGCATCTCCCGTGATGCA

Note: The stop codon of the coding sequence has to be deleted through primer design.

It is perhaps possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly.
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
INCOMPATIBLE WITH RFC[25]
Illegal NgoMIV site found at 546
Illegal AgeI site found at 636
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI.rc site found at 466

@@ Line 4: / Line 4: @@
 T7-RBS Intein-tag
-This part is a vector built for purifications of proteins.
+This part is a vector built for intein tag mediated purifications of proteins.
 ===Usage and Biology===
@@ Line 11: / Line 11: @@
 <center>
        <a href="https://static.igem.org/mediawiki/2014/e/e7/Bielefeld-CeBiTec_2014-10-14_InteinPurification.png" target="_blank"><img src="https://static.igem.org/mediawiki/2014/e/e7/Bielefeld-CeBiTec_2014-10-14_InteinPurification.png" width="250px"></a><br>
-<font size="2" style="text-align:center;"><b>Figure 16</b>: Scheme for intein mediated purification</font></center><br><br>
+<font size="2" style="text-align:center;"><b>Figure 1</b>: Scheme for intein mediated purification</font></center><br><br>
 For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-tag mediated purification system. The disadvantage of this system is that the tag remains attached to the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification (<a href="https://parts.igem.org/Part:BBa_K1465230" target="_blank">BBa_K1465230</a>).<br>
-By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification of the natural untagged protein can be achieved. The chitin binding domain binds the column at which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows the cleavage of the attached intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.<br>
+By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification of the natural untagged protein can be achieved. The chitin binding domain binds the column at which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows the cleavage of the attached intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column (Figure 1).<br>
 We implemented this system in the pSB1C3 backbone by combining the T7 promoter with RBS and intein tag with a chitin binding domain.<br>
   <center>
        <a href="https://static.igem.org/mediawiki/2014/c/c0/Bielefeld-CeBiTec_2014-10-16_PurificationVector.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c0/Bielefeld-CeBiTec_2014-10-16_PurificationVector.jpg" width="350px"></a><br>
-<font size="2" style="text-align:center;"><b>Figure 17</b>: Scheme vor purification vector</font></center><br><br>
+<font size="2" style="text-align:center;"><b>Figure 2</b>: Scheme vor purification vector</font></center><br><br>
 By designing Gibson Assembly primers with flanking overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):<br>
 <center>

Difference between revisions of "Part:BBa K1465230"

Latest revision as of 14:49, 18 October 2014

Usage and Biology

Protein purification