Revision as of 03:09, 18 October 2014 (view source) Bhollmann (Talk | contribs) ← Older edit		Revision as of 03:15, 18 October 2014 (view source) Bhollmann (Talk | contribs) Newer edit →
Line 4:		Line 4:
	T7-RBS Intein-tag		T7-RBS Intein-tag
		+	This part is a vector built for purifications of proteins.
	===Usage and Biology===		===Usage and Biology===

---

Revision as of 03:15, 18 October 2014

T7-RBS Intein-tag

T7-RBS Intein-tag

This part is a vector built for purifications of proteins.

Usage and Biology

Protein purification

Figure 16: Scheme for intein mediated purification

For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-tag mediated purification system. The disadvantage of this system is that the tag remains attached to the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification (BBa_K1465230).
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification of the natural untagged protein can be achieved. The chitin binding domain binds the column at which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows the cleavage of the attached intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.
We implemented this system in the pSB1C3 backbone by combining the T7 promoter with RBS and intein tag with a chitin binding domain.

Figure 17: Scheme vor purification vector

By designing Gibson Assembly primers with flanking overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):
>GSP_fw
CTATAGGGAAAGAGGAGAAAT
>GSP_rev
CTAGTGCATCTCCCGTGATGCA

Note: The stop codon of the coding sequence has to be deleted through primer design.

It is perhaps possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly.
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.

Sequence and Features