Difference between revisions of "Part:BBa K1431824:Design"

(Design Notes)
Line 12: Line 12:
 
# Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies ('''can select the positive colonies from the colony color'''), LB broth incubation, plasmid extraction and gel electrophoresis verification.
 
# Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies ('''can select the positive colonies from the colony color'''), LB broth incubation, plasmid extraction and gel electrophoresis verification.
 
# Cryopreserved the rest bacteria broth and send samples for sequencing.
 
# Cryopreserved the rest bacteria broth and send samples for sequencing.
 +
 +
===Sequencing Results===
 +
We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.
 +
 +
Sequence of sequencing primer we used:<br>
 +
VF2: tgccacctgacgtctaagaa<br>
 +
VR: attaccgcctttgagtgagc
 +
 +
The sequencing result is almost consistent with the sequence provided by Parts Registry except for a point mutation which doesn't influence essential part region or enzyme digestion site.
  
 
===Source===
 
===Source===

Revision as of 03:51, 18 October 2014

amajLime, yellow-green chromoprotein reporter system (Weak Promoter, Weak RBS)


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

This Biobrick is constructed through 3 steps:

  1. Do double enzyme digestion (XbaI & PstI for BBa_K1033916, SpeI & PstI for BBa_B0031) and do gel extraction, ligation, transformation, picking up single colonies, LB broth incubation, plasmid extraction and gel electrophoresis verification.
  2. Do double enzyme digestion (XbaI & PstI for Step 1 product, SpeI & PstI for J23106) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
  3. Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
  4. Cryopreserved the rest bacteria broth and send samples for sequencing.

Sequencing Results

We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.

Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc

The sequencing result is almost consistent with the sequence provided by Parts Registry except for a point mutation which doesn't influence essential part region or enzyme digestion site.

Source

The following list is the Biobricks we've used in construction and their detailed design information.

Part Type Discription Backbone Location on the plate
BBa_J23100 Promoter Strong Promoter BBa_J61002 (Amp) 17D 2014 Kit Plate 4
BBa_J23106 Promoter Weak Promoter BBa_J61002 (Amp) 17P 2014 Kit Plate 4
BBa_B0031 RBS Weak RBS pSB1A2 1H 2014 Kit Plate 4
BBa_B0034 RBS Strong RBS pSB1A2 1N 2014 Kit Plate 4
BBa_B0015 Terminator Strong terminator (B0010+B0012) pSB1C3 3F 2014 Kit Plate 3
BBa_K592009 Chromoprotein amilCP, blue chromoprotein pSB1C3 19E 2014 Kit Plate 1
BBa_K592011 Chromoprotein cjBlue, green chromoprotein pSB1C3 2I 2014 Kit Plate 4
BBa_K1033916 Chromoprotein amajLime, yellow-green chromoprote pSB1C3 6M 2014 Kit Plate 4

References

  1. Parts Registry Assembly Help
  2. Parts Registry Transformation Guideline