Difference between revisions of "Part:BBa K1351022"

Revision as of 18:48, 30 October 2014

FsrA: Fur-regulated sRNA which binds the binding site sdhC

This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI:	GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI:	TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Sequence and Features

Assembly Compatibility:

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K1351022 short</partinfo><br>
-Regulatory rRNA wich binds the binding site sdhC'.
+This part was generated with the RFC10 standard and has the following prefix and suffix:
+{|
+|prefix with EcoRI, NotI and XbaI:
+|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>G
+|-
+|suffix with SpeI, NotI and PstI:
+|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
+|}
+Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
+This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
 Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]