Difference between revisions of "Part:BBa K1431401:Design"

(→‎Method)
Line 10: Line 10:
 
We used a method derived from the method described in the paper by Feng Zhang<sup>[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA]</sup>.
 
We used a method derived from the method described in the paper by Feng Zhang<sup>[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA]</sup>.
  
−
1.As mentioned in main page:
 
  
−
2.Conserved Sequence Analysis
 
  
−
3.Strip out sequences without PAM
+
==== Conserved Sequence Analysis ====
 +
 
 +
We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.
 +
 
 +
==== Strip out sequences without PAM ====
 +
 
 +
{| class="wikitable"
 +
! colspan="11" | Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp
 +
|-
 +
|
 +
| A %
 +
| G %
 +
| C %
 +
| T %
 +
| Empty %
 +
| Non Empty %
 +
| A(Corrected)
 +
| G(Corrected)
 +
| C(Corrected)
 +
| T(Corrected)
 +
|-
 +
| 730
 +
| 0
 +
| 0
 +
| 0
 +
| 56.47
 +
| 43.53
 +
| 56.47
 +
| 0.00%
 +
| 0.00%
 +
| 0.00%
 +
| 100.00%
 +
|-
 +
| 731
 +
| 0
 +
| 55.88
 +
| 0
 +
| 0.59
 +
| 43.53
 +
| 56.47
 +
| 0.00%
 +
| 98.96%
 +
| 0.00%
 +
| 1.04%
 +
|-
 +
| 732
 +
| 0
 +
| 0
 +
| 0
 +
| 56.47
 +
| 43.53
 +
| 56.47
 +
| 0.00%
 +
| 0.00%
 +
| 0.00%
 +
| 100.00%
 +
|-
 +
| 733
 +
| 0
 +
| 54.71
 +
| 0
 +
| 1.18
 +
| 43.53
 +
| 55.89
 +
| 0.00%
 +
| 97.89%
 +
| 0.00%
 +
| 2.11%
 +
|-
 +
| 734
 +
| 0
 +
| 0
 +
| 0
 +
| 58.24
 +
| 41.76
 +
| 58.24
 +
| 0.00%
 +
| 0.00%
 +
| 0.00%
 +
| 100.00%
 +
|-
 +
| 735
 +
| 56.47
 +
| 0.59
 +
| 0.59
 +
| 0.59
 +
| 41.76
 +
| 58.24
 +
| 96.96%
 +
| 1.01%
 +
| 1.01%
 +
| 1.01%
 +
|-
 +
| 736
 +
| 0
 +
| 1.18
 +
| 57.06
 +
| 0
 +
| 41.76
 +
| 58.24
 +
| 0.00%
 +
| 2.03%
 +
| 97.97%
 +
| 0.00%
 +
|-
 +
| 737
 +
| 1.18
 +
| 57.06
 +
| 0
 +
| 0.59
 +
| 41.18
 +
| 58.83
 +
| 2.01%
 +
| 96.99%
 +
| 0.00%
 +
| 1.00%
 +
|-
 +
| 738
 +
| 60
 +
| 0
 +
| 0
 +
| 0
 +
| 40
 +
| 60
 +
| 100.00%
 +
| 0.00%
 +
| 0.00%
 +
| 0.00%
 +
|-
 +
| 739
 +
| 0.59
 +
| 0
 +
| 58.82
 +
| 0
 +
| 40
 +
| 59.41
 +
| 0.99%
 +
| 0.00%
 +
| 99.01%
 +
| 0.00%
 +
|-
 +
| 740
 +
| 0
 +
| 0
 +
| 0
 +
| 0
 +
| 100
 +
| 0
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
| 741
 +
| 0
 +
| 0
 +
| 0
 +
| 0
 +
| 100
 +
| 0
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
| 742
 +
| 0.59
 +
| 0
 +
| 1.18
 +
| 58.24
 +
| 40
 +
| 60.01
 +
| 0.98%
 +
| 0.00%
 +
| 1.97%
 +
| 97.05%
 +
|-
 +
| 743
 +
| 0
 +
| 0
 +
| 60
 +
| 0
 +
| 40
 +
| 60
 +
| 0.00%
 +
| 0.00%
 +
| 100.00%
 +
| 0.00%
 +
|-
 +
| 744
 +
| 0
 +
| 1.18
 +
| 58.82
 +
| 0
 +
| 40
 +
| 60
 +
| 0.00%
 +
| 1.97%
 +
| 98.03%
 +
| 0.00%
 +
|-
 +
| 745
 +
| 0
 +
| 58.82
 +
| 1.18
 +
| 0
 +
| 40
 +
| 60
 +
| 0.00%
 +
| 98.03%
 +
| 1.97%
 +
| 0.00%
 +
|-
 +
| 746
 +
| 0.59
 +
| 0
 +
| 59.41
 +
| 0
 +
| 40
 +
| 60
 +
| 0.98%
 +
| 0.00%
 +
| 99.02%
 +
| 0.00%
 +
|-
 +
| 747
 +
| 0.59
 +
| 59.41
 +
| 0
 +
| 0
 +
| 40
 +
| 60
 +
| 0.98%
 +
| 99.02%
 +
| 0.00%
 +
| 0.00%
 +
|-
 +
| 748
 +
| 0.59
 +
| 59.41
 +
| 0
 +
| 0
 +
| 40
 +
| 60
 +
| 0.98%
 +
| 99.02%
 +
| 0.00%
 +
| 0.00%
 +
|-
 +
| 749
 +
| 0
 +
| 58.82
 +
| 0.59
 +
| 0.59
 +
| 40
 +
| 60
 +
| 0.00%
 +
| 98.03%
 +
| 0.98%
 +
| 0.98%
 +
|-
 +
| 750
 +
| 0.59
 +
| 0.59
 +
| 58.24
 +
| 0.59
 +
| 40
 +
| 60.01
 +
| 0.98%
 +
| 0.98%
 +
| 97.05%
 +
| 0.98%
 +
|-
 +
| 751
 +
| 60
 +
| 0
 +
| 0
 +
| 0
 +
| 40
 +
| 60
 +
| 100.00%
 +
| 0.00%
 +
| 0.00%
 +
| 0.00%
 +
|-
 +
| 752
 +
| 59.41
 +
| 0.59
 +
| 0
 +
| 0
 +
| 40
 +
| 60
 +
| 99.02%
 +
| 0.98%
 +
| 0.00%
 +
| 0.00%
 +
|}
 +
 
 +
==== Select gRNA sequences with the best theoretical quality ====
 +
 
 +
{| class="wikitable"
 +
! colspan="5" | HIV-1 Quasi-Conservative gRNAs(Useful)
 +
|-
 +
| Sequence
 +
| Rating(Zhang)
 +
| Rank(Church)
 +
| Free Energy(Approx.)
 +
|
 +
|-
 +
| GTGTGGAAAATCTCTAGCAGTGG
 +
| 71
 +
| -
 +
| -1.4
 +
| rowspan="2" | HIV1_REF_2010
 +
|-
 +
| TCTAGCAGTGGCGCCCGAACAGG
 +
| 97
 +
| -
 +
| -1.3
 +
|}
 +
 
  
 
Select gRNA sequences with the best theoretical quality
 
Select gRNA sequences with the best theoretical quality

Revision as of 19:21, 17 October 2014

One gRNA Sequence for HIV-1


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Method

We used a method derived from the method described in the paper by Feng Zhang[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA].


Conserved Sequence Analysis

We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.

Strip out sequences without PAM

Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp
A % G % C % T % Empty % Non Empty % A(Corrected) G(Corrected) C(Corrected) T(Corrected)
730 0 0 0 56.47 43.53 56.47 0.00% 0.00% 0.00% 100.00%
731 0 55.88 0 0.59 43.53 56.47 0.00% 98.96% 0.00% 1.04%
732 0 0 0 56.47 43.53 56.47 0.00% 0.00% 0.00% 100.00%
733 0 54.71 0 1.18 43.53 55.89 0.00% 97.89% 0.00% 2.11%
734 0 0 0 58.24 41.76 58.24 0.00% 0.00% 0.00% 100.00%
735 56.47 0.59 0.59 0.59 41.76 58.24 96.96% 1.01% 1.01% 1.01%
736 0 1.18 57.06 0 41.76 58.24 0.00% 2.03% 97.97% 0.00%
737 1.18 57.06 0 0.59 41.18 58.83 2.01% 96.99% 0.00% 1.00%
738 60 0 0 0 40 60 100.00% 0.00% 0.00% 0.00%
739 0.59 0 58.82 0 40 59.41 0.99% 0.00% 99.01% 0.00%
740 0 0 0 0 100 0
741 0 0 0 0 100 0
742 0.59 0 1.18 58.24 40 60.01 0.98% 0.00% 1.97% 97.05%
743 0 0 60 0 40 60 0.00% 0.00% 100.00% 0.00%
744 0 1.18 58.82 0 40 60 0.00% 1.97% 98.03% 0.00%
745 0 58.82 1.18 0 40 60 0.00% 98.03% 1.97% 0.00%
746 0.59 0 59.41 0 40 60 0.98% 0.00% 99.02% 0.00%
747 0.59 59.41 0 0 40 60 0.98% 99.02% 0.00% 0.00%
748 0.59 59.41 0 0 40 60 0.98% 99.02% 0.00% 0.00%
749 0 58.82 0.59 0.59 40 60 0.00% 98.03% 0.98% 0.98%
750 0.59 0.59 58.24 0.59 40 60.01 0.98% 0.98% 97.05% 0.98%
751 60 0 0 0 40 60 100.00% 0.00% 0.00% 0.00%
752 59.41 0.59 0 0 40 60 99.02% 0.98% 0.00% 0.00%

Select gRNA sequences with the best theoretical quality

HIV-1 Quasi-Conservative gRNAs(Useful)
Sequence Rating(Zhang) Rank(Church) Free Energy(Approx.)
GTGTGGAAAATCTCTAGCAGTGG 71 - -1.4 HIV1_REF_2010
TCTAGCAGTGGCGCCCGAACAGG 97 - -1.3


Select gRNA sequences with the best theoretical quality

Advantage

Why do we design plasmids that only carry gRNA sequence without Cas9?

One main thought of our project is to achieve the transferring of Cas9 system and gRNA sequences into human body separately at different period of time. As you know, there are two parts in our CRISPER system, one is the Cas9 proteins, and the other is the gRNA. To begin with, Cas9 system will be stably transfected into human cells firstly, remaining inactivated and just waiting for orders. While the transportation of gRNA will not be performed until the diseases have developed, and types of retrovirus that cause these diseases are confirmed. Then, since the type of the pathogenic retrovirus has been known at this moment, we can design a gRNA that can specifically recognize the very type of retrovirus, and transfer it into human body. Finally these gRNA will combine with activated Cas9 proteins, guiding them to the genome sequence of retrovirus, at last destroying it. By this way, we can achieve a more specific introduction of gRNA into human cells, specifically targeting for the very type of retrovirus that caused the disease. The separated transportations of the two parts may also partially overcome the difficulties of radical cure, always met in usual treatment, due to the high variability of retrovirus.

Source

Conserved Region of the HIV-1 Genome from the NIH HIV-1 Sequence Database

References