Difference between revisions of "Part:BBa K1442117:Design"
| Line 1: | Line 1: | ||
| − | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1442117 short</partinfo> | <partinfo>BBa_K1442117 short</partinfo> | ||
| Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
| + | |||
| + | == Image of sequence == | ||
| + | |||
| + | [[File:Promoters_Diagram.jpg]] | ||
| + | |||
| + | |||
| + | == DNA == | ||
| + | |||
| + | 5’ GGTTGAACCGTACGCCTTTGTAAATAAACG 3’ | ||
| + | |||
| + | |||
| + | |||
| + | == RNA and secondary structure == | ||
| + | |||
| + | [[File:SLdel+8.png]] | ||
| + | |||
| + | |||
| + | == Features == | ||
| + | |||
| + | [[File:1Paper.jpg]] | ||
| + | |||
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLdel+8 (lane 10) does not perform very well in directing replication of a correct sized template and produces a large amount of faulty products. | Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLdel+8 (lane 10) does not perform very well in directing replication of a correct sized template and produces a large amount of faulty products. | ||
| + | |||
| + | == Ribozyme == | ||
| + | |||
| + | The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand. | ||
| + | |||
| + | [[File:Rib1.gif]] | ||
| + | |||
| + | The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system. | ||
| + | |||
| + | The structure of the molecule and its active site in particular are shown below. | ||
| + | |||
| + | [[File:Rib2.gif]] | ||
| Line 14: | Line 46: | ||
Brome Mosaic Virus | Brome Mosaic Virus | ||
| + | |||
| + | B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/] | ||
| + | |||
| + | “Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna | ||
===References=== | ===References=== | ||
Revision as of 14:10, 16 October 2014
Sldel+8 3
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 24
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 24
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 24
Illegal NgoMIV site found at 48
Illegal NgoMIV site found at 77 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 40
Design Notes
Image of sequence
DNA
5’ GGTTGAACCGTACGCCTTTGTAAATAAACG 3’
RNA and secondary structure
Features
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLdel+8 (lane 10) does not perform very well in directing replication of a correct sized template and produces a large amount of faulty products.
Ribozyme
The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand.
The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system.
The structure of the molecule and its active site in particular are shown below.
Source
Brome Mosaic Virus
B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/]
“Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna