Difference between revisions of "Add a Part to the Registry"
(→Deleting A Part) |
(Vitamin B12 with eforRed, red chromoprotein) |
||
Line 11: | Line 11: | ||
Basic Parts are discrete functional units of DNA. They cannot be subdivided into smaller component parts. DNA for a basic part may be obtained by ''de novo'' synthesis, by total synthesis based on a sequence from GenBank, by primer extension and PCR, or via other techniques. Like all parts, a Basic Part is stored in a plasmid, flanked by restriction-enzyme cloning regions ("BioBrick ends"). These cloning region are ''not'' included in the sequence of the part as defined by the Registry. They can be provided by the Registry software. Here is an [[Part:BBa_B0010:Design|example]] of a Basic Part. New users: check out these[[Help:An Introduction to BioBricks| important notes regarding BioBricks™ and basic part standardization.]]<br> | Basic Parts are discrete functional units of DNA. They cannot be subdivided into smaller component parts. DNA for a basic part may be obtained by ''de novo'' synthesis, by total synthesis based on a sequence from GenBank, by primer extension and PCR, or via other techniques. Like all parts, a Basic Part is stored in a plasmid, flanked by restriction-enzyme cloning regions ("BioBrick ends"). These cloning region are ''not'' included in the sequence of the part as defined by the Registry. They can be provided by the Registry software. Here is an [[Part:BBa_B0010:Design|example]] of a Basic Part. New users: check out these[[Help:An Introduction to BioBricks| important notes regarding BioBricks™ and basic part standardization.]]<br> | ||
− | + | gatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagc | |
− | + | ggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcgg | |
− | + | cggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatc | |
+ | atgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgt | ||
+ | acgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaacc | ||
+ | gtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgta | ||
+ | tgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaa | ||
+ | tgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaagg | ||
+ | aggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgacc | ||
+ | aaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctccca | ||
==='''Construction Intermediates''' [https://parts.igem.org/cgi/partsdb/add_part_ci.cgi Add a Construction Intermediate Now...]=== | ==='''Construction Intermediates''' [https://parts.igem.org/cgi/partsdb/add_part_ci.cgi Add a Construction Intermediate Now...]=== |
Revision as of 06:38, 6 April 2015
Just starting? Need help? Check out our documentation on How to make a Biobrick!
Or maybe you're looking for how to standardize a non-Biobrick sequence before you add it?
Members of Registry groups may add three kinds of parts to the registry:
Basic Parts, Composite Parts, and Construction Intermediates.
Basic Parts Add a Basic Part Now...
Basic Parts are discrete functional units of DNA. They cannot be subdivided into smaller component parts. DNA for a basic part may be obtained by de novo synthesis, by total synthesis based on a sequence from GenBank, by primer extension and PCR, or via other techniques. Like all parts, a Basic Part is stored in a plasmid, flanked by restriction-enzyme cloning regions ("BioBrick ends"). These cloning region are not included in the sequence of the part as defined by the Registry. They can be provided by the Registry software. Here is an example of a Basic Part. New users: check out these important notes regarding BioBricks™ and basic part standardization.
gatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagc ggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcgg cggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatc atgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgt acgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaacc gtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgta tgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaa tgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaagg aggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgacc aaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctccca
Construction Intermediates Add a Construction Intermediate Now...
Construction Intermediates have no specific function and are just the result of assembling two parts together. They require no further documentation. Often they are unwanted byproducts of construction They all have the type 'Intermediate' and part names of the form 'BBa_Snnnnn'. These part names are automatically assigned by the Registry software. Once you enter your intermediate part in the Registry, you will be able to use BioBrick Blast to check your assembly's sequence and your part will show up in the subpart and superpart search functions. If you send us the DNA, we will be able to share your work with others and include it in assemblies done by the Registry. There are no examples of these parts available yet.
Deleting A Part
You can try to delete a part by going to a part's "Hard Information" and setting the DNA status to "deleted".
The most important feature of a standard biological part should be that a user of the part does not have to talk to you, the designer of the part. This is achieved by completely documenting the part.