Difference between revisions of "Part:BBa K823038"

Line 72: Line 72:
 
<br>
 
<br>
  
 +
=== Further characterization ===
 +
 +
Performed by the [https://2019.igem.org/Team:TU_Dresden TU_Dresden 2019]
 +
 +
==== Strep-tag column purification ====
 +
 +
This BioBrick was used in the composite BioBrick [https://parts.igem.org/Part:BBa_K3037003 BBa_K3037003] which was purified using the “Expression and purification of proteins using Strep-Tactin” protocol of IBA Lifescience. The results of the following gel shows that the purification doesn't worked.
 +
 +
<gallery mode="packed", caption="Purification of proteins", widths=400px, heights=200px>
 +
File:T--TU_Dresden--Strep-tag_purification_BBa_3037003.png|<span style="color:#0000ff"> ''Strep-tactin column purification''  </span> (Purification of the composite BioBrick BBa_K3037003)
 +
</gallery>
 +
 +
Then the Strep-tag was used again in a different BioBrick, [https://parts.igem.org/Part:BBa_K3037009 BBa_K3037009]
 +
 +
This time the protocol was also the “Expression and purification of proteins using Strep-Tactin” of IBA Lifescience but this time the buffers used were made without EDTA.
 +
 +
<gallery mode="packed", caption="Purification of proteins", widths=400px, heights=200px>
 +
File:T--TU_Dresden--Strep-tag_purification_BBa_3037009.png|<span style="color:#0000ff"> ''Strep-tactin column purification''  </span> (Purification of the composite BioBrick BBa_K3037009)
 +
</gallery>
 +
 +
==== Conclusions ====
 +
 +
From the results of the purifications we conclude that the Strep-tag doesn't works for column purification, and should be used only for Western Blots as it was meant to be.
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 17:38, 20 October 2019

Strep-tag (Freiburg standard+RBS)

Streptavidin - tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT


The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, A. and Schmidt, T.G.M. (1999)]). Its sequence is WSHPQFEK. It can be used for protein purification, immobilisation with Streptavidin or Strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, S. and Skerra, A. (1997)]) or detection with Strep-tactin or antibodies.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

  • Strep - tag


Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox]. This part was also evaluated in the publication [http://www.jbioleng.org/content/7/1/29 The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis] by Radeck et al..

Evaluation

All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in Bacillus subtils using pSBBs0K-Pspac. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.

LMU-Western Blot Tags.png

Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.

Methods

To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here].


GFP

Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).


StrepII

Strep-Tactin-HRP conjugate (IBA, Strep-Tactin-HRP conjugate, No. 2-1502-001) 1:100 in 1 × PBS (4 mM KH2PO4; 16 mM Na2HPO4; 115 mM NaCl) with 0.1% (w/v) Tween20 was used.


Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a FusionTM imaging system (Peqlab).



Further characterization

Performed by the TU_Dresden 2019

Strep-tag column purification

This BioBrick was used in the composite BioBrick BBa_K3037003 which was purified using the “Expression and purification of proteins using Strep-Tactin” protocol of IBA Lifescience. The results of the following gel shows that the purification doesn't worked.

Then the Strep-tag was used again in a different BioBrick, BBa_K3037009

This time the protocol was also the “Expression and purification of proteins using Strep-Tactin” of IBA Lifescience but this time the buffers used were made without EDTA.

Conclusions

From the results of the purifications we conclude that the Strep-tag doesn't works for column purification, and should be used only for Western Blots as it was meant to be.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]