Difference between revisions of "Part:BBa K823034"

Revision as of 15:03, 9 January 2014 (view source) Jara (Talk | contribs) (→‎Evaluation) ← Older edit		Revision as of 16:25, 22 January 2014 (view source) Jara (Talk | contribs) Newer edit →
Line 32:		Line 32:
	===Evaluation [under construction]===		===Evaluation [under construction]===
	<p align="justify">		<p align="justify">
−	All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in ''Bacillus subtils'' using [https://parts.igem.org/Part:BBa_K823026 pSB<sub><i>Bs</sub></i>0K-P<sub><i>spac</sub></i>. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.	+	All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in ''Bacillus subtils'' using [https://parts.igem.org/Part:BBa_K823026 pSB<sub>Bs</sub>0K-P<sub>spac</sub>. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.
	Cells were disrupted by sonification and protein extract was loaded on a 12% SDS-PAGE. Proteins were subsequently transferred to a Nitrocellulose membrane, incubated with tag- (or GFP-)specific antibodies as well as secondary antibodies couples to HRP. HRP-activity was detected with chemicals in a Luminometer.		Cells were disrupted by sonification and protein extract was loaded on a 12% SDS-PAGE. Proteins were subsequently transferred to a Nitrocellulose membrane, incubated with tag- (or GFP-)specific antibodies as well as secondary antibodies couples to HRP. HRP-activity was detected with chemicals in a Luminometer.

---

Revision as of 16:25, 22 January 2014

3x FLAG tag (Freiburg standard+RBS)

3x FLAG tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html T.P. Hopp, K.S. Prickett et al. (1988)]). It consists of eight hydrophobic aminoacids: DYKDDDDK and the 3x Flag tag is: DYKDHDGDYKDHDIDYKDDDDK. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

• 3x Flag - tag

• HA - tag

• cMyc - tag

• His - tag

• Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Evaluation [under construction]

All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in Bacillus subtils using [https://parts.igem.org/Part:BBa_K823026 pSB_Bs0K-P_spac. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene. Cells were disrupted by sonification and protein extract was loaded on a 12% SDS-PAGE. Proteins were subsequently transferred to a Nitrocellulose membrane, incubated with tag- (or GFP-)specific antibodies as well as secondary antibodies couples to HRP. HRP-activity was detected with chemicals in a Luminometer. The detailed protocol can be found here [to be added soon].

File:LMU-Western Blot Tags.tif Fig. 1: Western Blots of all epitope tags fused to GFP.

<p align="justify">

All clones show a usual growth behaviour. The activity of the promoters increases during transition from log to stationary phase. The maximum (t=1h) reaches from 200Lumi/OD₆₀₀ (promoter J23115) to a maximum of 1500 Lumi/OD₆₀₀ for the strongest promoter (J23101). Afterwards the activity goes down to the beginning level (t=2h). The oscillation of luminescence (Lumi/OD₆₀₀) in the beginning of the curves are due to the small OD₆₀₀ values and do not mean high promoter activity. One clone of J23107 and J23114 shows significantly lower promoter activity. Therefore, additional clones should be measured. In comparison to all the other evaluated Bacillus promoters, these Anderson promoters showed a very low acitivity in B. subtilis.

Usage and Biology

Sequence and Features