Difference between revisions of "Part:BBa K1122674"

(Generation of protein fusion)
(Evidence for presence of protein fusion)
Line 26: Line 26:
 
<span class='h3bb'>DNA level evidence</span>
 
<span class='h3bb'>DNA level evidence</span>
  
 +
Primers were designed to amplify the region of fusion (region with deleted RBS). Those primers were used for PCR on fused and non-fused pdc and adhB.
  
 
[[File:bioethanol3.jpg]]
 
[[File:bioethanol3.jpg]]
  
[[File:bioethanol_sequencing.zip]]
+
Fig 3. 2.5% agarose gel analysing PCR product created using primers amplifying the region of putative gene fusion. As expected fusion product  (first 3 lanes) is smaller than non-fusion (last 3 lanes).
  
 +
 +
The same set of primers was used for sequencing of pdc-adhB fusion construct. Obtained results indicate that the fused state was present on a DNA level:
 +
 +
[[File:bioethanol_sequencing.zip]]
 +
Presence of following DNA sequence: GTAAACCGGTGAATAAACTGCTGGCATCAAGCACCTTTTATATCC corresponding to reverse complement of reverse primer followed by forward primer sequences indicates that gene fusion was obtained.
  
 
<span class='h3bb'>Protein level evidence</span>
 
<span class='h3bb'>Protein level evidence</span>
  
 +
In order to express fused pdc-adhB the construct was placed under the control of J33207 – IPTG inducible promoter combined with LacZ reporter.
 +
 +
Full grown cultures expressing pdc-adhB fusion and non-fusion were lysed and analysed on SDS-PAGE:
  
 
[[File:bioethanol4.jpg]]
 
[[File:bioethanol4.jpg]]
 +
 +
Fig 4. Scan of SDS-PAGE following Coomassie Brilliant Blue G250 staining. Within induced non-fusion lanes two intense bands are present (with size corresponding to pdc and adhB). Within induced fusion lanes described bands are missing and an additional band of increased size is observed. In vector only lane none of above described bands is present. To see full SDS-PAGE go to Appendix figure 2 on Edinburgh iGEM 2013 wiki
 +
 +
In order to present that functionality of adhB is attributed to a peptide of a different mass in fusion state  than in non-fusion state a native PAGE was performed.
  
 
[[File:bioethanol5.jpg]]
 
[[File:bioethanol5.jpg]]
 +
 +
Fig 5. Native PAGE stained for AdhB activity. Enzymatic activity can be attributed to a peptide of an increased mass in the fusion state than in non-fusion state.
 +
 +
Moreover, it was presented that pdc and adhB activity can be attributed to same gel band showing that fusion state was indeed obtained:
  
 
[[File:bioethanol6.jpg]]
 
[[File:bioethanol6.jpg]]
 +
 +
Fig 6. Native pages with adhB and pdc staining. Both activities are present in a band just below the well. Due to different acrylamide concentration used the fused protein was unable to migrate into the gel as opposed to PAGE present on figure 5.
  
  

Revision as of 13:55, 3 October 2013

Plac+fused PDC-ADH

lac promoter plus PDC-ADH fusion protein for ethanol production


Generation of protein fusion

In order to generate fusion of pyruvate decarboxylase (pdc) and alcohol dehydrogense B (adhB) Mutagenesis with Blunt- Ended Ligation (MABEL) was used.

A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process.


Bioethanol1.jpg

Fig1. Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region.


Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.):

Bioethanol2.jpg

Fig 2.Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel.

Evidence for presence of protein fusion

DNA level evidence

Primers were designed to amplify the region of fusion (region with deleted RBS). Those primers were used for PCR on fused and non-fused pdc and adhB.

Bioethanol3.jpg

Fig 3. 2.5% agarose gel analysing PCR product created using primers amplifying the region of putative gene fusion. As expected fusion product (first 3 lanes) is smaller than non-fusion (last 3 lanes).


The same set of primers was used for sequencing of pdc-adhB fusion construct. Obtained results indicate that the fused state was present on a DNA level:

File:Bioethanol sequencing.zip Presence of following DNA sequence: GTAAACCGGTGAATAAACTGCTGGCATCAAGCACCTTTTATATCC corresponding to reverse complement of reverse primer followed by forward primer sequences indicates that gene fusion was obtained.

Protein level evidence

In order to express fused pdc-adhB the construct was placed under the control of J33207 – IPTG inducible promoter combined with LacZ reporter.

Full grown cultures expressing pdc-adhB fusion and non-fusion were lysed and analysed on SDS-PAGE:

Bioethanol4.jpg

Fig 4. Scan of SDS-PAGE following Coomassie Brilliant Blue G250 staining. Within induced non-fusion lanes two intense bands are present (with size corresponding to pdc and adhB). Within induced fusion lanes described bands are missing and an additional band of increased size is observed. In vector only lane none of above described bands is present. To see full SDS-PAGE go to Appendix figure 2 on Edinburgh iGEM 2013 wiki

In order to present that functionality of adhB is attributed to a peptide of a different mass in fusion state than in non-fusion state a native PAGE was performed.

Bioethanol5.jpg

Fig 5. Native PAGE stained for AdhB activity. Enzymatic activity can be attributed to a peptide of an increased mass in the fusion state than in non-fusion state.

Moreover, it was presented that pdc and adhB activity can be attributed to same gel band showing that fusion state was indeed obtained:

Bioethanol6.jpg

Fig 6. Native pages with adhB and pdc staining. Both activities are present in a band just below the well. Due to different acrylamide concentration used the fused protein was unable to migrate into the gel as opposed to PAGE present on figure 5.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 1109
    Illegal AgeI site found at 2315
  • 1000
    COMPATIBLE WITH RFC[1000]

Functional Parameters

Bioethanol7.jpg

Activity of adhB as a fusion member


Bioethanol8.jpg

Microscopy of cells expressing fused protein


Bioethanol9.jpg