Difference between revisions of "Part:BBa K1122674"
(→Evidence for presence of protein fusion) |
(→Generation of protein fusion) |
||
| Line 6: | Line 6: | ||
===Generation of protein fusion=== | ===Generation of protein fusion=== | ||
| + | In order to generate fusion of pyruvate decarboxylase (pdc) and alcohol dehydrogense B (adhB) Mutagenesis with Blunt- Ended Ligation (MABEL) was used. | ||
| + | |||
| + | A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process. | ||
| + | |||
[[File:bioethanol1.jpg]] | [[File:bioethanol1.jpg]] | ||
| + | Fig1. Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region. | ||
| + | |||
| + | |||
| + | Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.): | ||
[[File:bioethanol2.jpg]] | [[File:bioethanol2.jpg]] | ||
| + | Fig 2.Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel. | ||
===Evidence for presence of protein fusion=== | ===Evidence for presence of protein fusion=== | ||
Revision as of 13:51, 3 October 2013
Plac+fused PDC-ADH
lac promoter plus PDC-ADH fusion protein for ethanol production
Generation of protein fusion
In order to generate fusion of pyruvate decarboxylase (pdc) and alcohol dehydrogense B (adhB) Mutagenesis with Blunt- Ended Ligation (MABEL) was used.
A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process.
Fig1. Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region.
Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.):
Fig 2.Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel.
Evidence for presence of protein fusion
DNA level evidence
File:Bioethanol sequencing.zip
Protein level evidence
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 1109
Illegal AgeI site found at 2315 - 1000COMPATIBLE WITH RFC[1000]
Functional Parameters
Activity of adhB as a fusion member
Microscopy of cells expressing fused protein
