Difference between revisions of "Part:BBa J31001:Design"

Revision as of 15:28, 27 July 2006

DNA invertase Hin tagged with LVA

Design Notes

This part is cloned in plasmid pSB1A2.

Biobricks

The Biobricks on this part are not wildtype but the cut sites are still viable.

GAATTCGCGGCCGC-TCTAGA-TGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTGTGACCGCATTTTTGAGGACCGTATCAGTGGCAAGATTGCAAACCGCCCCGGCCTGAAA CGAGCGTTAAAGTATGTAAATAAAGGCGATACTCTTGTCGTCTGGAAATTAGACAGACTGGGCCGCAGCGTGAAAAACCTGGTGGCGTTAATATCAGAATTACATGAACGTGGAGCTCACTTCCATTCTTTAACCGATAG TATTGATACCAGTAGCGCGATGGGGCGATTCTTTTTTCATGTAATGTCAGCACTGGCCGAGATGGAGCGAGAATTAATTGTCGAGCGAACCCTTGCCGGACTGGCTGCCGCCAGAGCGCAAGGACGACTGGGAGGGCG CCCTCGGGCGATCAACAGACATGAACAGGAACAGATTAGTCGGCTATTAGAGAAAGGCCATCCTCGGCAGCAACTAGCTATTATTTTTGGTATTGGCGTATCTACCTTATACAGATATTTTCCGGCAAGCCGTATAAAAA AACGAATGAATAGGCCTGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTA-ACTAGTTGCGGCCGCCTGCAG

There is no T spacer between the NotI site and the XbaI site.

There is no G spacer between the XbaI and the insert.

There is no T spacer between the insert and the SpeI site.

The T spacer between the SpeI and the NotI sites should be an A.

The last C of the NotI site is not conserved with the initial C from the PstI site.

The BB suffix currently has this sequence for the NotI and PstI sites GCGGCCGcCTGCAG But it should have been: GCGGCCGCTGCAG

We compared our BioBricks with those from Tom Knight's paper, Idempotent Vector Design for Standard Assembly of Biobricks. As seen below

Source

Salmonella typhimurium and the the Hin part without LVA.

References

Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks