Difference between revisions of "Part:BBa K1065203:Design"
(→Source) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1065203 short</partinfo> | <partinfo>BBa_K1065203 short</partinfo> | ||
Line 10: | Line 9: | ||
<html> | <html> | ||
− | The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br /> | + | The construct has been builded with a standard assembly. |
+ | The coding sequence of EFE gene was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br /> | ||
<br /> | <br /> | ||
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | <span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> |
Revision as of 08:57, 1 October 2013
Efe+Bba_B0015 in pSpac (BBa_K823026)
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 9491
Illegal suffix found in sequence at 1224 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 9491
Illegal SpeI site found at 1225
Illegal PstI site found at 1239
Illegal NotI site found at 1232
Illegal NotI site found at 9497 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 9491
Illegal BglII site found at 319
Illegal BglII site found at 7085
Illegal BamHI site found at 2601 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 9491
Illegal suffix found in sequence at 1225 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 9491
Illegal XbaI site found at 9506
Illegal SpeI site found at 1225
Illegal PstI site found at 1239
Illegal NgoMIV site found at 17
Illegal NgoMIV site found at 4148
Illegal AgeI site found at 1070
Illegal AgeI site found at 6696
Illegal AgeI site found at 7658
Illegal AgeI site found at 8333 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 3972
Illegal BsaI.rc site found at 5411
Illegal BsaI.rc site found at 7927
Illegal SapI site found at 2889
Illegal SapI.rc site found at 6909
Design Notes
The construct has been builded with a standard assembly.
The coding sequence of EFE gene was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.
GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...
...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG
Source
We used a CDS optimized for both E. coli and B. subtilis that was synthesized by Genescript.