Difference between revisions of "Part:BBa K1065203:Design"

(Source)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1065203 short</partinfo>
 
<partinfo>BBa_K1065203 short</partinfo>
Line 10: Line 9:
  
 
<html>
 
<html>
The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
+
The construct has been builded with a standard assembly. 
 +
The coding sequence of EFE gene was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
 
<br />
 
<br />
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>

Revision as of 08:57, 1 October 2013

Efe+Bba_B0015 in pSpac (BBa_K823026)


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal prefix found in sequence at 9491
    Illegal suffix found in sequence at 1224
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 9491
    Illegal SpeI site found at 1225
    Illegal PstI site found at 1239
    Illegal NotI site found at 1232
    Illegal NotI site found at 9497
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 9491
    Illegal BglII site found at 319
    Illegal BglII site found at 7085
    Illegal BamHI site found at 2601
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found in sequence at 9491
    Illegal suffix found in sequence at 1225
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found in sequence at 9491
    Illegal XbaI site found at 9506
    Illegal SpeI site found at 1225
    Illegal PstI site found at 1239
    Illegal NgoMIV site found at 17
    Illegal NgoMIV site found at 4148
    Illegal AgeI site found at 1070
    Illegal AgeI site found at 6696
    Illegal AgeI site found at 7658
    Illegal AgeI site found at 8333
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 3972
    Illegal BsaI.rc site found at 5411
    Illegal BsaI.rc site found at 7927
    Illegal SapI site found at 2889
    Illegal SapI.rc site found at 6909


Design Notes

The construct has been builded with a standard assembly. The coding sequence of EFE gene was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.

GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...

...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG

Source

We used a CDS optimized for both E. coli and B. subtilis that was synthesized by Genescript.

References