Difference between revisions of "Help:Terminators"
Smelissali (Talk | contribs) |
Smelissali (Talk | contribs) |
||
| Line 4: | Line 4: | ||
<hr> | <hr> | ||
| − | A terminator is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a [[Help:Protein coding|coding region]] attached to a regulatory region) | + | A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a [[Help:Protein coding|coding region]] attached to a regulatory region) |
==Stem-loop type terminators== | ==Stem-loop type terminators== | ||
| Line 10: | Line 10: | ||
One example of a biobrick which uses this method is the terminator [[Part:BBa_B0011]], which has the palindromic sequence "<font color = "green">aaaagccagattat</font><font color = "red">taatccggctttt</font>" | One example of a biobrick which uses this method is the terminator [[Part:BBa_B0011]], which has the palindromic sequence "<font color = "green">aaaagccagattat</font><font color = "red">taatccggctttt</font>" | ||
| + | ==Poly-A tails== | ||
| + | In eukaryotic hosts such as [https://parts.igem.org/wiki/index.php/Yeast yeast], a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA". | ||
==Rho type terminators== | ==Rho type terminators== | ||
Another method which cells use to terminate a sequence is through the action of the Rho protein. | Another method which cells use to terminate a sequence is through the action of the Rho protein. | ||
Revision as of 14:08, 29 June 2006
Browse terminator parts!
A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a coding region attached to a regulatory region)
Stem-loop type terminators
In our prokaryotic biobricks, host cells, these terminator parts are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.
One example of a biobrick which uses this method is the terminator Part:BBa_B0011, which has the palindromic sequence "aaaagccagattattaatccggctttt"
Poly-A tails
In eukaryotic hosts such as yeast, a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA".
Rho type terminators
Another method which cells use to terminate a sequence is through the action of the Rho protein.