Difference between revisions of "Part:BBa J45003:Design"

(→‎Primers)
(→‎Primers)
Line 1: Line 1:
 
==Primers==
 
==Primers==
−
Forward primer: 5'- <b>atg gag gta atg cga gtt ctt c</b> -3'
+
Forward primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA G<b>at gga ggt aat gcg agt tct tc</b> -3'
 +
 
 
Reverse primer: 5'- <b>accggttctaacgagcgaaag</b> -3'
 
Reverse primer: 5'- <b>accggttctaacgagcgaaag</b> -3'
  

Revision as of 16:21, 26 June 2006

Primers

Forward primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA Gat gga ggt aat gcg agt tct tc -3'

Reverse primer: 5'- accggttctaacgagcgaaag -3'

Design Consideration

This part would be used to make a jasmine scent.

Source

If we find a source, it will probably be donated by Seo et al. GENBANK Accession Number = BD441046

References

Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, and Choi YD. Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc Natl Acad Sci U S A 2001 Apr 10; 98(8) 4788-93. doi:10.1073/pnas.081557298 pmid:11287667. PubMed HubMed [Seo01]