Difference between revisions of "Part:BBa K1065000:Design"
(→Design Notes) |
(→Design Notes) |
||
Line 9: | Line 9: | ||
<html> | <html> | ||
− | Ethylene-forming enzyme that catalyses the formation of ethylene from 2-oxoglutarate. The coding sequence was taken from <I>Pseuhmonas syringa</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>b.Subtilis</I> and <I>e.Coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly. | + | Ethylene-forming enzyme that catalyses the formation of ethylene from 2-oxoglutarate. The coding sequence was taken from <I>Pseuhmonas syringa</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>b.Subtilis</I> and <I>e.Coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br/> |
− | + | ||
<span style= "color:yellow" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | <span style= "color:yellow" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | ||
<br/> | <br/> | ||
− | TCG<span style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span> | + | ...TCG<span style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span> |
</html> | </html> |
Revision as of 12:04, 24 June 2013
2-oxoglutarate oxygenase/decarboxylase (EFE)
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 319
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 17
Illegal AgeI site found at 1070 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
Ethylene-forming enzyme that catalyses the formation of ethylene from 2-oxoglutarate. The coding sequence was taken from Pseuhmonas syringa pv. phaseolicola PK2. We firstly optimized the codons for both b.Subtilis and e.Coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.
GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...
...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG
Source
xxxx