Difference between revisions of "Part:BBa K1065001:Design"
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1065001 short</partinfo> | <partinfo>BBa_K1065001 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | |||
+ | <html> | ||
+ | The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br /> | ||
+ | <br /> | ||
+ | <span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | ||
+ | <br/> | ||
+ | ...TCG<span style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span> | ||
+ | </html> | ||
+ | The AraC-pBAD promoter was taken from the UNITN iGEM 2012 team (<a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K731201">BBa_K731201</a>). | ||
===Source=== | ===Source=== | ||
− | + | Synthesized by GenScript®. | |
===References=== | ===References=== | ||
+ | <html><ol> | ||
+ | <li>GOTO,M .,I SHIDAY, .,T AKIKAWAY,. & HYODOH,. (1985). Ethylene | ||
+ | production by the Kudzu strains of <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.</li> | ||
+ | <li>Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Journal of General Microbiology 137: 2281–2286.</li> | ||
+ | <li>Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Biochem Biophys Res Commun 188: 826–832.</li> | ||
+ | <li>Fernando Guerrero, Vero´ nica Carbonell., Matteo Cossu., Danilo Correddu, Patrik R. Jones (2012) Ethylene Synthesis and Regulated Expression of | ||
+ | Recombinant Protein in <I>Synechocystis sp.</I> PCC 6803. PLoS ONE 7(11): e50470.</li> | ||
+ | </ol></html> |
Revision as of 07:53, 13 September 2013
AraC-pBAD + 2-oxoglutarate oxygenase/decarboxylase (EFE) + terminators
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1530
Illegal BamHI site found at 1144 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1228
Illegal AgeI site found at 979
Illegal AgeI site found at 2281 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 961
Design Notes
The coding sequence was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.
GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...
...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG
The AraC-pBAD promoter was taken from the UNITN iGEM 2012 team (<a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K731201">BBa_K731201</a>).
Source
Synthesized by GenScript®.
References
- GOTO,M .,I SHIDAY, .,T AKIKAWAY,. & HYODOH,. (1985). Ethylene production by the Kudzu strains of Pseudomonas syringae pv. phaseolicola causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.
- Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from Pseudomonas syringae pv. phaseolicola PK2. Journal of General Microbiology 137: 2281–2286.
- Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem Biophys Res Commun 188: 826–832.
- Fernando Guerrero, Vero´ nica Carbonell., Matteo Cossu., Danilo Correddu, Patrik R. Jones (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in Synechocystis sp. PCC 6803. PLoS ONE 7(11): e50470.