Difference between revisions of "Part:BBa J45503:Experience"
(→User Reviews) |
(→User Reviews) |
||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter | This experience page is provided so that any user may enter their experience using this part.<BR>Please enter | ||
Line 7: | Line 6: | ||
===User Reviews=== | ===User Reviews=== | ||
− | + | <!-- DON'T DELETE --><partinfo>BBa_J23119 StartReviews</partinfo> | |
− | <!-- DON'T DELETE --><partinfo> | + | |
<!-- Template for a user review | <!-- Template for a user review | ||
{|width='80%' style='border:1px solid gray' | {|width='80%' style='border:1px solid gray' | ||
Line 18: | Line 16: | ||
Enter the review inofrmation here. | Enter the review inofrmation here. | ||
|}; | |}; | ||
+ | <!-- End of the user review template --> | ||
+ | {|width='80%' style='border:1px solid gray' | ||
+ | |- | ||
+ | |width='10%'| | ||
+ | <partinfo>BBa_J45503 AddReview number</partinfo> | ||
+ | <I>Username</I> | ||
+ | |width='60%' valign='top'| | ||
+ | The 2005 UCSF iGEM team remarks, "By far, the best promoter is hybB, which controlls the hydrogenase II operon. It is clearly active at temperatures lower than 30oC and is off at temperatures higher than 30oC." | ||
+ | |} | ||
+ | |||
+ | {|width='80%' style='border:1px solid gray' | ||
+ | |- | ||
+ | |width='10%'| | ||
+ | <partinfo>BBa_K584001 AddReview 5</partinfo> | ||
+ | <I><B>[http://2011.igem.org/Team:KULeuven K.U.Leuven iGEM 2011 Team]</B></I> | ||
+ | |width='60%' valign='top'| | ||
+ | |||
+ | <u><b>Motivation of this Design/Usage - K.U.Leuven 2011 iGEM Team</b></u> | ||
+ | |||
+ | This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the [https://parts.igem.org/Part:BBa_K410000 K410000] as a template using the primers below - | ||
+ | |||
+ | <font color=#006600>hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG </font> | ||
+ | |||
+ | <font color=#006600>hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG </font> | ||
+ | |||
+ | <u><b>Characterization by K.U.Leuven 2011 iGEM Team</b></u> | ||
+ | <p align="justify">To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes].</p> | ||
+ | |||
+ | [[Image:HybB-GFP_TOP10.jpg|thumb|center|Figure1]] | ||
+ | |||
+ | [[Image:HybB-GFP_MG1655.jpg|thumb|center|Figure2]] | ||
+ | |||
+ | <p align="justify">We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system.</p> | ||
+ | |||
+ | |||
+ | |||
<!-- End of the user review template --> | <!-- End of the user review template --> | ||
<!-- DON'T DELETE --><partinfo>BBa_J45503 EndReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_J45503 EndReviews</partinfo> |
Revision as of 10:26, 21 September 2011
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_J45503
User Reviews
UNIQ9afa30313dcd2e18-partinfo-00000000-QINU
No review score entered. Username |
The 2005 UCSF iGEM team remarks, "By far, the best promoter is hybB, which controlls the hydrogenase II operon. It is clearly active at temperatures lower than 30oC and is off at temperatures higher than 30oC." |
•••••
[http://2011.igem.org/Team:KULeuven K.U.Leuven iGEM 2011 Team] |
Motivation of this Design/Usage - K.U.Leuven 2011 iGEM Team This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the K410000 as a template using the primers below - hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG Characterization by K.U.Leuven 2011 iGEM Team To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes]. We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system.
UNIQ9afa30313dcd2e18-partinfo-00000003-QINU |