Difference between revisions of "Part:BBa P1014:Design"

Revision as of 17:20, 19 June 2006

gentamicin resistance cassette aph(2)

Assembly Compatibility:

PCR primers
- gtttcttcgaattcgcggccgcttctagag gagataggttatgcaagat,P1014-F
- gtttcttcctgcagcggccgctactagta gattccggattctaaaaaaagg,P1014-R2 (after terminator)
- gtttcttcctgcagcggccgctactagta ctatttaattttaatgcttctg,P1014-R3 (after stop codon)

XbaI site at 660 removed by mutating c->t which also improves codon usage.
- gatgatttttacagggatattttagagaacgaaatctac,P1014-XF
- gtagatttcgttctctaaaatatccctgtaaaaatcatc,P1014-XR

Novel gentamicin resistance gene
Acquired by PCR from pTEX5500ts, GenbankDQ208936, kind gift of Barbara E. Murray.
pTEX5500ts was, in turn was derived from Genbank AF016483.

Nallapareddy SR, Singh KV, Murray BE. Construction of improved temperature-sensitive and mobilizable vectors and their use for constructing mutations in the adhesin-encoding acm gene of poorly transformable clinical Enterococcus. Appl Environ Microbiol. 2006 Jan;72(1):334-45 faecium strains. PMID 16391062

Tsai SF, Zervos MJ, Clewell DB, Donabedian SM, Sahm DF, Chow JW. A new high-level gentamicin resistance gene, aph(2)-Id, in Enterococcus spp. Antimicrob Agents Chemother. 1998 May;42(5):1229-32. PMID 9593155

@@ Line 23: / Line 23: @@
 ===References===
+* Nallapareddy SR, Singh KV, Murray BE. Construction of improved temperature-sensitive and mobilizable vectors and their use for constructing mutations in the adhesin-encoding acm gene of poorly transformable clinical Enterococcus. Appl Environ Microbiol. 2006 Jan;72(1):334-45 faecium strains.  PMID 16391062
+*Tsai SF, Zervos MJ, Clewell DB, Donabedian SM, Sahm DF, Chow JW. A new high-level gentamicin resistance gene, aph(2'')-Id, in Enterococcus spp.  Antimicrob Agents Chemother. 1998 May;42(5):1229-32.  PMID 9593155