Difference between revisions of "Part:BBa K823038"
Line 30: Line 30:
 
Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
 
Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
  
 +
===Evaluation===
 +
<p align="justify">
 +
All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in ''Bacillus subtils'' using [https://parts.igem.org/Part:BBa_K823026 pSB<sub>Bs</sub>0K-P<sub>spac</sub>]. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.
 +
 +
 +
</p>
 +
 +
{| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
 +
| style="width: 70%;background-color: #EBFCE4;" |
 +
{|
 +
|[[Image:LMU-Western_Blot_Tags.png|400px|center]]
 +
|-
 +
| style="width: 70%;background-color: #EBFCE4;" |
 +
{| style="color:black;" cellpadding="0" width="100%" cellspacing="0" border="0" align="center" style="text-align:center;"
 +
|style="width: 70%;background-color: #EBFCE4;" |
 +
<font color="#000000"; size="2"><p align="justify"> Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.
 +
 +
|}
 +
|}
 +
|}
 +
 +
===Methods===
 +
 +
 +
To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here]
 +
 +
 +
''GFP''
 +
 +
Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).
 +
 +
 +
''StrepII''
 +
 +
Strep-Tactin-HRP conjugate (IBA, Strep-Tactin-HRP conjugate, No. 2-1502-001) 1:100 in 1 × PBS (4 mM KH2PO4; 16 mM Na2HPO4; 115 mM NaCl) with 0.1% (w/v) Tween20 was used.
 +
 +
 +
Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a Fusion<sup>TM</sup> imaging system (Peqlab). 
 +
</p>
 +
<br>
 +
<br>
  
  

Revision as of 12:26, 3 February 2014

Strep-tag (Freiburg standard+RBS)

Streptavidin - tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT


The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, A. and Schmidt, T.G.M. (1999)]). Its sequence is WSHPQFEK. It can be used for protein purification, immobilisation with Streptavidin or Strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, S. and Skerra, A. (1997)]) or detection with Strep-tactin or antibodies.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

  • Strep - tag


Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Evaluation

All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in Bacillus subtils using pSBBs0K-Pspac. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.

LMU-Western Blot Tags.png

Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.

Methods

To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here]


GFP

Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).


StrepII

Strep-Tactin-HRP conjugate (IBA, Strep-Tactin-HRP conjugate, No. 2-1502-001) 1:100 in 1 × PBS (4 mM KH2PO4; 16 mM Na2HPO4; 115 mM NaCl) with 0.1% (w/v) Tween20 was used.


Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a FusionTM imaging system (Peqlab).




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]