Difference between revisions of "Part:BBa K823038"

Revision as of 08:55, 26 September 2012

Strep-tag (Freiburg standard+RBS)

Streptavidin - tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, A. and Schmidt, T.G.M. (1999)]). Its sequence is WSHPQFEK. It can be used for protein purification, immobilisation with Streptavidin or Strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, S. and Skerra, A. (1997)]) or detection with Strep-tactin or antibodies.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

• 3x Flag - tag

• HA - tag

• cMyc - tag

• His - tag

• Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features