Difference between revisions of "Part:BBa K823036"

Revision as of 08:55, 26 September 2012

cMyc-tag (Freiburg standard+RBS)

cMyc-tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The cMyc-tag is a tag derived from the cMyc gene product. Antibodies were derived from the immunisation with synthetic peptides from the cMyc sequence [http://mcb.asm.org/content/5/12/3610.short Mol. Cell. Biol. 5,3610-3616]). The aminoacid sequence is EQKLISEEDL.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

• 3x Flag - tag

• HA - tag

• cMyc - tag

• His - tag

• Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features