Difference between revisions of "Part:BBa K733001:Design"
(→Design Note) |
|||
| Line 1: | Line 1: | ||
===Design Note=== | ===Design Note=== | ||
| + | |||
| + | Design | ||
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter. | We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter. | ||
Revision as of 16:30, 22 September 2012
Design Note
Design
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter.
The sequences of these two primers are: Forward primer: 5’-CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGAT–3’(Prefix not shown) Reverse primer: 5’–CAATATCCCTTTTATCCATAGAAAAATATATCCTAAATATCT–3’ (Suffix not shown)
Source
Not available at this moment.