Difference between revisions of "Part:BBa K823036"

Revision as of 10:10, 8 September 2012

cMyc-tag (Freiburg standard+RBS)

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

cMyc-tag

His-tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

Revision as of 10:02, 8 September 2012 (view source) Dexios (Talk \| contribs) ← Older edit		Revision as of 10:10, 8 September 2012 (view source) Dexios (Talk \| contribs) Newer edit →
Line 2:		Line 2:
	<partinfo>BBa_K823036 short</partinfo>		<partinfo>BBa_K823036 short</partinfo>

−	cMyc-tag with RBS in Freiburg standard.	+	cMyc-tag with RBS in [[Help:Assembly_standard_25\|Freiburg standard]].