Difference between revisions of "Part:BBa K823036"

Revision as of 10:00, 8 September 2012

cMyc-tag (Freiburg standard+RBS)

cMyc-tag with RBS in Freiburg standard.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

Revision as of 09:59, 8 September 2012 (view source) Dexios (Talk \| contribs) ← Older edit		Revision as of 10:00, 8 September 2012 (view source) Dexios (Talk \| contribs) Newer edit →
Line 16:		Line 16:


−	~~See here~~ for ~~other~~ usefull parts of ~~the~~ [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].	+	Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].

	<!-- Add more about the biology of this part here		<!-- Add more about the biology of this part here