Difference between revisions of "Part:BBa K823036"

Revision as of 09:58, 8 September 2012

cMyc-tag (Freiburg standard+RBS)

cMyc-tag with RBS in Freiburg standard.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

See here for other usefull parts of the [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

@@ Line 3: / Line 3: @@
 cMyc-tag with RBS in Freiburg standard.
 prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
 suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
-This is a part created by the LMU-Munich 2012 team. See here for other usefull parts of the [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
+This is a part created by the LMU-Munich 2012 team.  We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:
+[Part:BBa_K823034|3x Flag tag],[Part:BBa_K823035|HA-tag],[Part:BBa_K823036|cMyc-tag],[Part:BBa_K823037|3x Flag tag],[Part:BBa_K823038|3x Flag tag]
+See here for other usefull parts of the [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
 <!-- Add more about the biology of this part here