Difference between revisions of "Part:BBa K823034"

Revision as of 11:49, 8 September 2012

3x FLAG tag (Freiburg standard+RBS)

3x Flag tag with RBS in Freiburg standard.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

3x Flag tag

HA-tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K823034 short</partinfo>
-x Flag tag with RBS in Freiburg standard.
+x Flag tag with RBS in [[Help:Assembly_standard_25|Freiburg standard]].
 prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
@@ Line 8: / Line 10: @@
 suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
-<!-- Add more about the biology of this part here
+This is a part created by the LMU-Munich 2012 team.  We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:
+[[Part:BBa_K823034|3x Flag tag]]
+[[Part:BBa_K823035|HA-tag]]
+[[Part:BBa_K823036|cMyc-tag]]
+[[Part:BBa_K823037|His-tag]]
+[[Part:BBa_K823038|Streptavidin-tag]]
+Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
 ===Usage and Biology===