Difference between revisions of "Part:BBa K638402:Experience"
| Line 9: | Line 9: | ||
===Producing BBa_k638402 from primer synthesis=== | ===Producing BBa_k638402 from primer synthesis=== | ||
| − | We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25]. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [www. | + | We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25]. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly]. |
| + | <html> | ||
<table border="1" style="text-align:center;word-wrap:break-word;width:700px;table-layout:fixed;"> | <table border="1" style="text-align:center;word-wrap:break-word;width:700px;table-layout:fixed;"> | ||
<tr> | <tr> | ||
| Line 27: | Line 28: | ||
<td>70.98°C</td> | <td>70.98°C</td> | ||
</tr> | </tr> | ||
| + | </html> | ||
| + | Thermocycler profile: | ||
| Line 39: | Line 42: | ||
<I>Username</I> | <I>Username</I> | ||
|width='60%' valign='top'| | |width='60%' valign='top'| | ||
| − | Enter the review | + | Enter the review information here. |
|}; | |}; | ||
<!-- End of the user review template --> | <!-- End of the user review template --> | ||
<!-- DON'T DELETE --><partinfo>BBa_K638402 EndReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_K638402 EndReviews</partinfo> | ||
Revision as of 10:49, 21 September 2011
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K638402
This is an improved version of part BBa_K233307 designed to allow comparison with measurements of functionality in the literature, and to make it easier to synthesise.
Producing BBa_k638402 from primer synthesis
We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as BBF RFC 23 or 25. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly].
| Name | Sequence | Tm |
|---|---|---|
| TorA Fwd | ATGGCGAACAACGACTTATTTCAGGCTTCTCGGCGTCGCTTTCTGGCGCAGCTGGGCGGATTAACGGTGGCGGGT | 70.98°C |
| TorA Rev | TGCGGCTTGTGCTGCCGTCGCTCTGCGAGGAGTCAACAGCGACGGGCCCAACATACCCGCCACCGTTAATCCGCC | 70.98°C |