Difference between revisions of "Part:BBa K371005:Design"

 
(Design Notes)
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K371005 short</partinfo>
 
<partinfo>BBa_K371005 short</partinfo>
Line 7: Line 6:
  
 
===Design Notes===
 
===Design Notes===
Sequencing result shows that there are several silent mutation in pduT and pduU. PduV has some error mutation. We are still working on the function assay to certify whether the mutation pduV still function well.
+
In the previous literature,most of research work on pdu BMC(or pdu MCP) focus on ''Citrobacter Freundii'' and ''Salmonella enteric''a. Taking all of the factors together, we choose ''Citrobacter Freundii'' as the orgin of gene in our project. Because the whole genome of Citrobacter Freundii has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1). In order to make the part Compatiblee with the BBF RFC10&RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment, we serached the restriction enzyme site EcoRI, XbaI, SpeI, PstI, EarI, SacI ,SapI and BglII site in pduTUV(18502-19813). Luckily, none of these was found in pduAB.
  
 +
We got the Citrobacter Freundii from NBRC(NBRC NO.12681). We isolate the whole genome of Citrobacter Freundii. Then we use this genoe as template to get pduTUV gene by PCR. Here is the primer we used in pduTUV PCR.
 +
<html>
 +
<div style="background:#FFFACD;padding-left:50px">
 +
<p>forward primer:</p>
 +
<p>5'-GTTT GAATTCGCGGCCGCTTCTAGAG CTGAGCAATCCATCACGGTAATAAG-3'</p> 
 +
<p>reverse primer</p>
 +
<p>5'-GTTT ACTAGTA TTATTTTGTGAGACAGGAAGATTCCTTTGCATTC-3' </p>
 +
</div>
 +
</html>
  
 +
The sequence results of pduTUV are different from the sequence we found on GeneBank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of Citrobacter Freundii. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduAB in Salmonella enterica and ours shows that the 'mutation' locate in the nonconserved site. Thus we decide to continue our experement with the gene pduTUV.
  
 
===Source===
 
===Source===

Latest revision as of 05:37, 27 October 2010

pduTUV(Propanediol utilization gene T+U+V)[RBS+pduT+RBS+pduU+RBS+pduV]


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 815
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

In the previous literature,most of research work on pdu BMC(or pdu MCP) focus on Citrobacter Freundii and Salmonella enterica. Taking all of the factors together, we choose Citrobacter Freundii as the orgin of gene in our project. Because the whole genome of Citrobacter Freundii has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1). In order to make the part Compatiblee with the BBF RFC10&RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment, we serached the restriction enzyme site EcoRI, XbaI, SpeI, PstI, EarI, SacI ,SapI and BglII site in pduTUV(18502-19813). Luckily, none of these was found in pduAB.

We got the Citrobacter Freundii from NBRC(NBRC NO.12681). We isolate the whole genome of Citrobacter Freundii. Then we use this genoe as template to get pduTUV gene by PCR. Here is the primer we used in pduTUV PCR.

forward primer:

5'-GTTT GAATTCGCGGCCGCTTCTAGAG CTGAGCAATCCATCACGGTAATAAG-3'

reverse primer

5'-GTTT ACTAGTA TTATTTTGTGAGACAGGAAGATTCCTTTGCATTC-3'

The sequence results of pduTUV are different from the sequence we found on GeneBank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of Citrobacter Freundii. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduAB in Salmonella enterica and ours shows that the 'mutation' locate in the nonconserved site. Thus we decide to continue our experement with the gene pduTUV.

Source

pduJK come from Citrobacter Freundii genenom(NBRC NO.12681)

References