Difference between revisions of "Part:BBa J70565:Design"

(→‎Design Notes)
(→‎Design Notes)
 
Line 6: Line 6:
  
 
===Design Notes===
 
===Design Notes===
−
A 10 amino Gly-Ser linker was chosen to maintain functionality of the dimer, but this was fairly arbitrary and the length of the intervening linker may need to be changed.
+
A 10 amino acid Gly-Ser linker was chosen to maintain functionality of the dimer, but this was fairly arbitrary and the length of the intervening linker may need to be changed.
  
−
Additionally, a missence mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtcc'''gc'''ata instead of cctgtcc'''cg'''ata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem.
+
Additionally, a mis-sense mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtcc'''gc'''ata instead of cctgtcc'''cg'''ata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem.
  
  
Line 17: Line 17:
 
Primer for correction of the missing SpeI site:
 
Primer for correction of the missing SpeI site:
 
  cgtactgcagcggccgctactagtat tattaggtatattccatgtggtacttc,LuxB-R
 
  cgtactgcagcggccgctactagtat tattaggtatattccatgtggtacttc,LuxB-R
 +
 +
Construction of a fused LuxAB gene by site-directed mutagenesis.
 +
Boylan MO, Pelletier J, Dhepagnon S, Trudel S, Sonenberg N, Meighen EA.
 +
J Biolumin Chemilumin. 1989 Jul;4(1):310-6.PMID: 2678919
  
 
===Source===
 
===Source===

Latest revision as of 21:00, 31 March 2010

luxAB Fusion gene, Xenorhabdus luminescens


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 530
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI site found at 1049


Design Notes

A 10 amino acid Gly-Ser linker was chosen to maintain functionality of the dimer, but this was fairly arbitrary and the length of the intervening linker may need to be changed.

Additionally, a mis-sense mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtccgcata instead of cctgtcccgata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem.


Primers for insertion of the linker region: 

accagacccaccaccacctgaacctcctcc taatagcgaacgttgtttttc,LuxA-R
ggt tca ggt ggt ggt ggg tct ggt gga gga tcg aaatttggattgttcttcc,LuxB-F

Primer for correction of the missing SpeI site: 

cgtactgcagcggccgctactagtat tattaggtatattccatgtggtacttc,LuxB-R

Construction of a fused LuxAB gene by site-directed mutagenesis. Boylan MO, Pelletier J, Dhepagnon S, Trudel S, Sonenberg N, Meighen EA. J Biolumin Chemilumin. 1989 Jul;4(1):310-6.PMID: 2678919

Source

Amplified from part K216008.

References