Difference between revisions of "Part:BBa K5317021"
(→Theoretical Part Design) |
|||
| (3 intermediate revisions by 2 users not shown) | |||
| Line 7: | Line 7: | ||
The cyclic AMP-dependent transcription factor ATF2 is a member of the basic leucine zipper domain (bZIP) DNA-binding protein family and is expressed by nearly all human cells (Miller ''et al.'', 2010). In these cells, ATF2 is phosphorylated by stress-activated protein kinase (SAPK) p38 and C-Jun N-terminal kinase (JNK) at amino acids Thr69 and Thr71 in response to a specific stimulus (Livingstone ''et al.'', 1995). This phosphorylation results in the formation of dimer structures that efficiently bind to the specific DNA consensus sequence 5′-TGACGTCA-3′ (Lin ''et al.'', 1988) in promoter regions of target genes. A short DNA fragment containing this consensus sequence element is called a cAMP response element (CRE) (Lin ''et al.'', 1988). This binding stimulates CRE-dependent transcription, thereby activating gene expression of genes involved in cell growth, stress responses, and apoptosis (Kawasaki ''et al.'', 2000; Miller ''et al.'', 2010). | The cyclic AMP-dependent transcription factor ATF2 is a member of the basic leucine zipper domain (bZIP) DNA-binding protein family and is expressed by nearly all human cells (Miller ''et al.'', 2010). In these cells, ATF2 is phosphorylated by stress-activated protein kinase (SAPK) p38 and C-Jun N-terminal kinase (JNK) at amino acids Thr69 and Thr71 in response to a specific stimulus (Livingstone ''et al.'', 1995). This phosphorylation results in the formation of dimer structures that efficiently bind to the specific DNA consensus sequence 5′-TGACGTCA-3′ (Lin ''et al.'', 1988) in promoter regions of target genes. A short DNA fragment containing this consensus sequence element is called a cAMP response element (CRE) (Lin ''et al.'', 1988). This binding stimulates CRE-dependent transcription, thereby activating gene expression of genes involved in cell growth, stress responses, and apoptosis (Kawasaki ''et al.'', 2000; Miller ''et al.'', 2010). | ||
| − | An interesting discovery by Miller and colleagues in 2010 shows that ATF2 is phosphorylated by the bacterial serine/threonine kinase PknB, specifically at Thr73. In our cell-based β-lactam ring-containing antibiotics sensor which is based on the antibiotic-detecting PknB kinase (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317013 K5317013]</span>), ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of our engineered | + | An interesting discovery by Miller and colleagues in 2010 shows that ATF2 is phosphorylated by the bacterial serine/threonine kinase PknB, specifically at Thr73. In our cell-based β-lactam ring-containing antibiotics sensor which is based on the antibiotic-detecting PknB kinase (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317013 K5317013]</span>), ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of our engineered 3xCre3xAP1-miniCMV promoter (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317017 K5317017]</span>). |
| − | + | ||
=Cloning= | =Cloning= | ||
===Theoretical Part Design=== | ===Theoretical Part Design=== | ||
| − | We placed the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) downstream of ATF2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317016 K5317016]</span>), leading to a fusion of the reporter C-terminally. The CMV promoter, provided by the EGFP-C2 backbone (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338020 K3338020]</span>), | + | We placed the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) downstream of ATF2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317016 K5317016]</span>), leading to a fusion of the reporter C-terminally. The CMV promoter, provided by the EGFP-C2 backbone (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338020 K3338020]</span>), enables a constitutive expression of the fusion protein in mammalian cells (Radhakrishnan ''et al.'', 2008). |
===Sequence and features=== | ===Sequence and features=== | ||
| Line 111: | Line 110: | ||
Figure 2: Single-transfected HEK293T cells with the ATF2-mRuby2-C2 plasmid depicted under unstimulated conditions. Scale bar = 20 µm. | Figure 2: Single-transfected HEK293T cells with the ATF2-mRuby2-C2 plasmid depicted under unstimulated conditions. Scale bar = 20 µm. | ||
| − | The correct expression of ATF2-mRuby2 was assumed, since the representative images in figure 2 show a | + | The correct expression of ATF2-mRuby2 was assumed, since the representative images in figure 2 show a mostly nuclear localization of the mRuby2 signal in HEK293T cells. The already primary nuclear localization of ATF2 could be due to other mechanisms that activate ATF2 endogenously, since it is a mammalian transcription factor. Due to its physiological occurrence in mammalian cells, we decided to use ATF2 as a crucial signal forwarding factor to mediate between the detecting PknB protein and the signal emitting 3xCre3xAP1-miniCMV promoter. |
| − | Due to its physiological | + | |
===Co-transfection with PknB-EGFP=== | ===Co-transfection with PknB-EGFP=== | ||
| Line 131: | Line 129: | ||
===Triple-transfection experiments with EGFP-PknB and 3xCre3xAP1-miniCMV=== | ===Triple-transfection experiments with EGFP-PknB and 3xCre3xAP1-miniCMV=== | ||
| − | The composite parts ATF2-mRuby2, EGFP-PknB (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317018 K5317018]</span>) and 3xCre3xAP1-miniCMV-miRFP670 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317022 K5317022]</span>) integrated into backbone plasmids were co-transfected into HEK293T cells, with and without ampicillin supplementation of the media for four hours, to possibly detect changes in the miRFP670 signal. This provides information on whether our own promoter is | + | The composite parts ATF2-mRuby2, EGFP-PknB (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317018 K5317018]</span>) and 3xCre3xAP1-miniCMV-miRFP670 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317022 K5317022]</span>) integrated into backbone plasmids were co-transfected into HEK293T cells, with and without ampicillin supplementation of the media for four hours, to possibly detect changes in the miRFP670 signal. This provides information on whether our own promoter is recognized by the signal transmitter ATF2 after its activation by PknB with or without ampicillin present in the media. Therefore, providing necessary information about the functionality of our multi component sensor system. |
| Line 143: | Line 141: | ||
Figure 4: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and 3xCre3xAP1-miniCMV-miRFP670. Shown are the fluorescence channels for EGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation. In order to standardise the signal strength, a contrast ratio of 25% for 3xCre3xAP1-miniCMV-miRFP670 was selected. This approach allows for the preservation of individual signal intensities through an overlay, ensuring their continued visibility. Scale bar = 10 µm. | Figure 4: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and 3xCre3xAP1-miniCMV-miRFP670. Shown are the fluorescence channels for EGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation. In order to standardise the signal strength, a contrast ratio of 25% for 3xCre3xAP1-miniCMV-miRFP670 was selected. This approach allows for the preservation of individual signal intensities through an overlay, ensuring their continued visibility. Scale bar = 10 µm. | ||
| − | The representative HEK293T cells (Figure 4) co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2, as well as our promoter-reporter construct 3xCre3xAP1-miniCMV-miRFP670 emitted signals in all three channels, indicating successful transfections. EGFP-PknB expression is shown in green, ATF2-mRuby2 expression in red, and the reporter miRFP670 expression in pink. Particularly noteworthy is again the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane. To study whether the presence of beta-lactam antibiotics in the cell media will be sensed by PknB, leading to a phosphorylation of ATF2 and subsequently to an induction of our promoter-driven reporter fluorophore miRFP670, we incubated co-transfected HEK293T cells with ampicillin ( | + | The representative HEK293T cells (Figure 4) co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2, as well as our promoter-reporter construct 3xCre3xAP1-miniCMV-miRFP670 emitted signals in all three channels, indicating successful transfections. EGFP-PknB expression is shown in green, ATF2-mRuby2 expression in red, and the reporter miRFP670 expression in pink. Particularly noteworthy is again the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane. To study whether the presence of beta-lactam antibiotics in the cell media will be sensed by PknB, leading to a phosphorylation of ATF2 and subsequently to an induction of our promoter-driven reporter fluorophore miRFP670, we incubated co-transfected HEK293T cells with ampicillin (100 µg/mL) for four hours. This led to a higher miRFP670 signal compared to unstimulated conditions. The detectable miRFFP670 signal even without the presence of ampicillin could be explained by possible binding of ATF2 to the 3xCre3xAP1-sites after its activation via other mammalian mechanisms, since ATF2 is a mammalian transcription factor and possibly endogenously expressed and active. Nevertheless, the representative images of the miRFP670 channel indicate an increase in fluorescence intensity after ampicillin incubation, suggesting a functional PASTA domain activity followed by ATF2 phosphorylation leading to miRFP670 expression. |
=References= | =References= | ||
Latest revision as of 11:23, 2 October 2024
CMV-ATF2-mRuby2
Usage and Biology
The cyclic AMP-dependent transcription factor ATF2 is a member of the basic leucine zipper domain (bZIP) DNA-binding protein family and is expressed by nearly all human cells (Miller et al., 2010). In these cells, ATF2 is phosphorylated by stress-activated protein kinase (SAPK) p38 and C-Jun N-terminal kinase (JNK) at amino acids Thr69 and Thr71 in response to a specific stimulus (Livingstone et al., 1995). This phosphorylation results in the formation of dimer structures that efficiently bind to the specific DNA consensus sequence 5′-TGACGTCA-3′ (Lin et al., 1988) in promoter regions of target genes. A short DNA fragment containing this consensus sequence element is called a cAMP response element (CRE) (Lin et al., 1988). This binding stimulates CRE-dependent transcription, thereby activating gene expression of genes involved in cell growth, stress responses, and apoptosis (Kawasaki et al., 2000; Miller et al., 2010).
An interesting discovery by Miller and colleagues in 2010 shows that ATF2 is phosphorylated by the bacterial serine/threonine kinase PknB, specifically at Thr73. In our cell-based β-lactam ring-containing antibiotics sensor which is based on the antibiotic-detecting PknB kinase (K5317013), ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of our engineered 3xCre3xAP1-miniCMV promoter (K5317017).
Cloning
Theoretical Part Design
We placed the mRuby2 fluorescent marker (K5317001) downstream of ATF2 (K5317016), leading to a fusion of the reporter C-terminally. The CMV promoter, provided by the EGFP-C2 backbone (K3338020), enables a constitutive expression of the fusion protein in mammalian cells (Radhakrishnan et al., 2008).
Sequence and features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 670
Illegal SapI.rc site found at 2408
Cloning
The ATF2 insert was synthesized and the mRuby2 sequence amplifyed using the primers in table 1. The primers ensured approx. 20 bp-long overhangs at the 5' and 3' ends of the amplicons compatible with the backbone. We linearized EGFP-C2 with BamHI and AseI. The composite part-containing plasmid was assembled using the NEBBuilder® HIFI assembly kit, whereby the overhangs ensured the correct positioning of the insert in the backbone.
| Primer name | Sequence |
|---|---|
| ATF2_fw | TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag |
| ATF2_rev | ggatccccacttcctgagggctgtgac |
| mRuby2_fw | caggaagtggggatccaccggtcg |
| mRuby2_rev | TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc |
Figure 1: Assembled vector map with the ATF2 and mRuby2 inserts integrated into the pEGFP-C2 backbone, whereby mRuby2 is positioned downstream of ATF2, ensuring its C-terminally fusion to ATF2.
Characterisation
Transfection experiments in mammalian HEK293T cells assessed the functionality and sensitivity of ATF2. First, the composite part carrying plasmid was introduced via transfection to ensure the physiological localisation of ATF2 before co-transfecting experiments with the CMV-EGFP-PknB carrying plasmid (K5317018) and 3xCre3xAP1-miniCMV carrying plasmid (K5317022). The mRuby2 fluorescence signal was analyzed for localization by microscopy and quantifyed by FACS analysis.
Single-transfection experiments
To determine the basal expression and localization of ATF2 under unstimulated conditions, ATF2-mRuby2 expressing HEK293T cells were imaged without the presence of ampicillin.
Figure 2: Single-transfected HEK293T cells with the ATF2-mRuby2-C2 plasmid depicted under unstimulated conditions. Scale bar = 20 µm.
The correct expression of ATF2-mRuby2 was assumed, since the representative images in figure 2 show a mostly nuclear localization of the mRuby2 signal in HEK293T cells. The already primary nuclear localization of ATF2 could be due to other mechanisms that activate ATF2 endogenously, since it is a mammalian transcription factor. Due to its physiological occurrence in mammalian cells, we decided to use ATF2 as a crucial signal forwarding factor to mediate between the detecting PknB protein and the signal emitting 3xCre3xAP1-miniCMV promoter.
Co-transfection with PknB-EGFP
To test if PknB activation by the presence of beta-lactams lead to intracellular translocation of ATF2, we performed co-transfection experiments and exposed those HEK293T cells to ampicillin or remained them under unstimulated conditions.
Figure 3: The montage shows representative images of double-transfected CMV-PknB-EGFP and CMV-ATF2-mRuby2 HEK293T cells with and without ampicillin stimulation. Shown are brightfield (left), fluorescence channels for eGFP and mRuby2 and an overlay of the three channels with and without coloured signals (right). Scale bar = 100 µm.
The Co-transfection experiments showed that PknB and ATF2 do not inhibit each other's co-expression and that both are possibly interacting. Under ampicillin stimulating conditions, both signals increase slightly. This paring of kinase and transcription factor can be used for further experiments with the 3xCre3xAP1-miniCMV promoter to fully assemble the cell-based antibiotic sensor and test its responsiveness to beta-lactam exposure.
Triple-transfection experiments with EGFP-PknB and 3xCre3xAP1-miniCMV
The composite parts ATF2-mRuby2, EGFP-PknB (K5317018) and 3xCre3xAP1-miniCMV-miRFP670 (K5317022) integrated into backbone plasmids were co-transfected into HEK293T cells, with and without ampicillin supplementation of the media for four hours, to possibly detect changes in the miRFP670 signal. This provides information on whether our own promoter is recognized by the signal transmitter ATF2 after its activation by PknB with or without ampicillin present in the media. Therefore, providing necessary information about the functionality of our multi component sensor system.
Figure 4: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and 3xCre3xAP1-miniCMV-miRFP670. Shown are the fluorescence channels for EGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation. In order to standardise the signal strength, a contrast ratio of 25% for 3xCre3xAP1-miniCMV-miRFP670 was selected. This approach allows for the preservation of individual signal intensities through an overlay, ensuring their continued visibility. Scale bar = 10 µm.
The representative HEK293T cells (Figure 4) co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2, as well as our promoter-reporter construct 3xCre3xAP1-miniCMV-miRFP670 emitted signals in all three channels, indicating successful transfections. EGFP-PknB expression is shown in green, ATF2-mRuby2 expression in red, and the reporter miRFP670 expression in pink. Particularly noteworthy is again the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane. To study whether the presence of beta-lactam antibiotics in the cell media will be sensed by PknB, leading to a phosphorylation of ATF2 and subsequently to an induction of our promoter-driven reporter fluorophore miRFP670, we incubated co-transfected HEK293T cells with ampicillin (100 µg/mL) for four hours. This led to a higher miRFP670 signal compared to unstimulated conditions. The detectable miRFFP670 signal even without the presence of ampicillin could be explained by possible binding of ATF2 to the 3xCre3xAP1-sites after its activation via other mammalian mechanisms, since ATF2 is a mammalian transcription factor and possibly endogenously expressed and active. Nevertheless, the representative images of the miRFP670 channel indicate an increase in fluorescence intensity after ampicillin incubation, suggesting a functional PASTA domain activity followed by ATF2 phosphorylation leading to miRFP670 expression.
References
Lin, Y. S., & Green, M. R. (1988). Interaction of a common cellular transcription factor, ATF, with regulatory elements in both E1a- and cyclic AMP-inducible promoters. Proceedings of the National Academy of Sciences of the United States of America, 85(10), 3396–3400. https://doi.org/10.1073/pnas.85.10.3396
Livingstone, C., Patel, G., & Jones, N. (1995). ATF-2 contains a phosphorylation-dependent transcriptional activation domain. The EMBO journal, 14(8), 1785–1797. https://doi.org/10.1002/j.1460-2075.1995.tb07167.x
Miller, M., Donat, S., Rakette, S., Stehle, T., Kouwen, T. R., Diks, S. H., Dreisbach, A., Reilman, E., Gronau, K., Becher, D., Peppelenbosch, M. P., van Dijl, J. M., & Ohlsen, K. (2010). Staphylococcal PknB as the first prokaryotic representative of the proline-directed kinases. PloS one, 5(2), e9057. https://doi.org/10.1371/journal.pone.0009057
Kirsch, K., Zeke, A., Tőke, O., Sok, P., Sethi, A., Sebő, A., Kumar, G. S., Egri, P., Póti, Á. L., Gooley, P., Peti, W., Bento, I., Alexa, A., & Reményi, A. (2020). Co-regulation of the transcription controlling ATF2 phosphoswitch by JNK and p38. Nature Communications, 11(1), 5769. https://doi.org/10.1038/s41467-020-19582-3
Radhakrishnan, P., Basma, H., Klinkebiel, D., Christman, J., & Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2’-deoxycytidine. The International Journal of Biochemistry & Cell Biology, 40(9), 1944–1955. https://doi.org/10.1016/j.biocel.2008.02.014