Difference between revisions of "Part:BBa K5317019"

(→‎Usage and Biology)
(→‎Single-transfection experiments)
 
(10 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
===Usage and Biology===
 
===Usage and Biology===
  
−
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317017 K5317017]</span>). We therefore fused an mRuby2 marker gene (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) to detect localization of ccpA protein in HEK292T cells.
+
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317017 K5317017]</span>). We, therefore, fused a mRuby2 marker gene (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) to detect localization of the CcpA protein in HEK292T cells.
 +
 
 +
=Cloning=
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
−
Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) allows for visualisation of location of ccpA.  
+
CcpA was codon-optimized for the expression in mammalian systems and synthesized with the correct approx. 20 bp overhangs for introduction into a backbone plasmid. Placing the CcpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>) upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) allows for visualization of expression and localization of CcpA.
−
<!-- -->
+
−
<span class='h3bb'>
+
  
 
===Sequence and Features===
 
===Sequence and Features===
−
</span>
+
 
 
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
  
 
===Cloning===
 
===Cloning===
−
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from ''S. aureus''. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.This composite part was cloned by using the primers in table 1.
+
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) downstream, generation a fusion protein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol. This composite part was cloned by using the primers in table 1.
  
 
<html>  
 
<html>  
Line 47: Line 47:
 
   <tr>  
 
   <tr>  
  
−
     <td>ccpA_fw_1</td>  
+
     <td>CcpA_fw</td>  
  
−
     <td>tggatccccttttgtagttcctcggtattcaattctgtgag</td>  
+
     <td>TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc</td>  
  
 
   </tr>  
 
   </tr>  
Line 55: Line 55:
 
   <tr>  
 
   <tr>  
  
−
     <td>ccpA_rv_2</td>  
+
     <td>CcpA_rev</td>  
  
−
     <td>TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc</td>  
+
     <td>tggatccccttttgtagttcctcggtattcaattctgtgag</td>
 
  </tr>  
 
  </tr>  
  
 
   <tr>  
 
   <tr>  
  
−
     <td>ccpA_fw_3</td>  
+
     <td>mRuby_fw</td>  
  
 
     <td>actacaaaaggggatccaccggtcg</td>  
 
     <td>actacaaaaggggatccaccggtcg</td>  
Line 69: Line 69:
 
   <tr>  
 
   <tr>  
  
−
     <td>ccpA_rv_4</td>  
+
     <td>mRuby2_rev</td>  
  
 
     <td>TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc</td>  
 
     <td>TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc</td>  
Line 80: Line 80:
  
 
</body>  
 
</body>  
−
+
 
−
 
+
−
+
−
 
+
 
</html>
 
</html>
  
Line 92: Line 89:
 
</center>
 
</center>
 
</html>
 
</html>
 +
Figure 1: Vector map of the assembled CMV-CcpA-mRuby cassette in the C2 backbone plasmid.
  
 
=Characterisation=
 
=Characterisation=
−
Transfection experiments of CcpA in mammalian HEK cells to show localisation and activation of CcpA in unstimulated conditions. This is was one of three possible transcription factors we analysed within this project. However, this protein was unable to be expressed in HEK cells and was not further investigated.
+
We conducted transfection experiments of CMV-CcpA-mRuby2 in mammalian HEK293T cells to show the localization of CcpA under unstimulated conditions.
  
 
===Single-transfection experiments===
 
===Single-transfection experiments===
Line 100: Line 98:
 
<html>
 
<html>
 
<center>
 
<center>
−
<img src="https://static.igem.wiki/teams/5317/cmv-mruby2-ccpa-single-transfection.png"style ="width: 70%; height: 70%">
+
<img src="https://static.igem.wiki/teams/5317/cmv-mruby2-ccpa-single-transfection.png"style ="width: 90%; height: 90%">
 
</p>
 
</p>
 
</center>
 
</center>
 
</html>
 
</html>
  
−
Figure 2: Depicted HEK cells transfected with CMV-ccpA-mRuby2 containing plasmid. Scaling (bottom right) is 10 µM.  
+
Figure 2: Depicted HEK293T cells transfected with CMV-CcpA-mRuby2 containing plasmid. Scale bar = 10 µm.  
  
−
In Figure 2 are transfected CMV-ccpA-mRuby2-HEK cells shown. CcpA did show any fluorescent signal and did not lead to any further investigations.
+
The CMV-CcpA-mRuby2-transfected HEK293T cells in the representative images in figure 2 depicted no fluorescent signal and therefore no further experiments were conducted with this transcription factor.
  
 
=References=
 
=References=

Latest revision as of 07:05, 2 October 2024

CMV-CcpA-mRuby2


Usage and Biology

The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (K5317017). We, therefore, fused a mRuby2 marker gene (K5317001) to detect localization of the CcpA protein in HEK292T cells.

Cloning

Theoretical Part Design

CcpA was codon-optimized for the expression in mammalian systems and synthesized with the correct approx. 20 bp overhangs for introduction into a backbone plasmid. Placing the CcpA (K3338014) upstream of the reporter gene mRuby2 (K5317001) allows for visualization of expression and localization of CcpA.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1669

Cloning

We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (K33380014) and mRuby2 (K3338001) downstream, generation a fusion protein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol. This composite part was cloned by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract and clone the ccpA gene sequence.

Primer name Sequence
CcpA_fw TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc
CcpA_rev tggatccccttttgtagttcctcggtattcaattctgtgag
mRuby_fw actacaaaaggggatccaccggtcg
mRuby2_rev TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Figure 1: Vector map of the assembled CMV-CcpA-mRuby cassette in the C2 backbone plasmid.

Characterisation

We conducted transfection experiments of CMV-CcpA-mRuby2 in mammalian HEK293T cells to show the localization of CcpA under unstimulated conditions.

Single-transfection experiments

Figure 2: Depicted HEK293T cells transfected with CMV-CcpA-mRuby2 containing plasmid. Scale bar = 10 µm.

The CMV-CcpA-mRuby2-transfected HEK293T cells in the representative images in figure 2 depicted no fluorescent signal and therefore no further experiments were conducted with this transcription factor.

References

Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. Journal of Bacteriology, 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21

Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587