Difference between revisions of "Part:BBa K5317019"

(Single-transfection experiments)
 
(22 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
===Usage and Biology===
 
===Usage and Biology===
  
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. This phosphorylation-dependent mechanism enables S. aureus to adapt to different environmental conditions, thereby increasing its survivability and virulence (Liao ''et al.'', 2022). We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to a specifically engineered promoter. We therefore used an mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>)marker gene to detect expression of ccpA protein.
+
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317017 K5317017]</span>). We, therefore, fused a mRuby2 marker gene (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) to detect localization of the CcpA protein in HEK292T cells.
 +
 
 +
=Cloning=
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) allows for visualisation of location of ccpA. This composite part was amplified by using the primers in table 1.
+
CcpA was codon-optimized for the expression in mammalian systems and synthesized with the correct approx. 20 bp overhangs for introduction into a backbone plasmid. Placing the CcpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>) upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) allows for visualization of expression and localization of CcpA.
 +
 
 +
===Sequence and Features===
 +
 
 +
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
 +
 
 +
===Cloning===
 +
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) downstream, generation a fusion protein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol. This composite part was cloned by using the primers in table 1.
  
 
<html>  
 
<html>  
Line 38: Line 47:
 
   <tr>  
 
   <tr>  
  
     <td>ccpA_fw_1</td>  
+
     <td>CcpA_fw</td>  
  
     <td>tggatccccttttgtagttcctcggtattcaattctgtgag</td>  
+
     <td>TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc</td>  
  
 
   </tr>  
 
   </tr>  
Line 46: Line 55:
 
   <tr>  
 
   <tr>  
  
     <td>ccpA_rv_2</td>  
+
     <td>CcpA_rev</td>  
  
     <td>TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc</td>  
+
     <td>tggatccccttttgtagttcctcggtattcaattctgtgag</td>
 
  </tr>  
 
  </tr>  
  
 
   <tr>  
 
   <tr>  
  
     <td>ccpA_fw_3</td>  
+
     <td>mRuby_fw</td>  
  
 
     <td>actacaaaaggggatccaccggtcg</td>  
 
     <td>actacaaaaggggatccaccggtcg</td>  
Line 60: Line 69:
 
   <tr>  
 
   <tr>  
  
     <td>ccpA_rv_4</td>  
+
     <td>mRuby2_rev</td>  
  
 
     <td>TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc</td>  
 
     <td>TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc</td>  
Line 71: Line 80:
  
 
</body>  
 
</body>  
+
 
 +
</html>
  
+
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/ccpa-mruby2.png" style="width: 50%; height: 50%">
 +
</p>
 +
</center>
 +
</html>
 +
Figure 1: Vector map of the assembled CMV-CcpA-mRuby cassette in the C2 backbone plasmid.
  
 +
=Characterisation=
 +
We conducted transfection experiments of CMV-CcpA-mRuby2 in mammalian HEK293T cells to show the localization of CcpA under unstimulated conditions. 
 +
 +
===Single-transfection experiments===
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/cmv-mruby2-ccpa-single-transfection.png"style ="width: 90%; height: 90%">
 +
</p>
 +
</center>
 
</html>
 
</html>
<!-- -->
 
<span class='h3bb'>
 
  
===Sequence and Features===
+
Figure 2: Depicted HEK293T cells transfected with CMV-CcpA-mRuby2 containing plasmid. Scale bar = 10 µm.
</span>
+
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
+
  
===Cloning===
+
The CMV-CcpA-mRuby2-transfected HEK293T cells in the representative images in figure 2 depicted no fluorescent signal and therefore no further experiments were conducted with this transcription factor.
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from ''S. aureus''. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.
+
  
===References===
+
=References=
  
 
Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. ''Journal of Bacteriology'', 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21
 
Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. ''Journal of Bacteriology'', 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21
  
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587

Latest revision as of 07:05, 2 October 2024

CMV-CcpA-mRuby2


Usage and Biology

The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (K5317017). We, therefore, fused a mRuby2 marker gene (K5317001) to detect localization of the CcpA protein in HEK292T cells.

Cloning

Theoretical Part Design

CcpA was codon-optimized for the expression in mammalian systems and synthesized with the correct approx. 20 bp overhangs for introduction into a backbone plasmid. Placing the CcpA (K3338014) upstream of the reporter gene mRuby2 (K5317001) allows for visualization of expression and localization of CcpA.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1669

Cloning

We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (K33380014) and mRuby2 (K3338001) downstream, generation a fusion protein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol. This composite part was cloned by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract and clone the ccpA gene sequence.

Primer name Sequence
CcpA_fw TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc
CcpA_rev tggatccccttttgtagttcctcggtattcaattctgtgag
mRuby_fw actacaaaaggggatccaccggtcg
mRuby2_rev TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Figure 1: Vector map of the assembled CMV-CcpA-mRuby cassette in the C2 backbone plasmid.

Characterisation

We conducted transfection experiments of CMV-CcpA-mRuby2 in mammalian HEK293T cells to show the localization of CcpA under unstimulated conditions.

Single-transfection experiments

Figure 2: Depicted HEK293T cells transfected with CMV-CcpA-mRuby2 containing plasmid. Scale bar = 10 µm.

The CMV-CcpA-mRuby2-transfected HEK293T cells in the representative images in figure 2 depicted no fluorescent signal and therefore no further experiments were conducted with this transcription factor.

References

Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. Journal of Bacteriology, 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21

Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587