Difference between revisions of "Part:BBa K5317015"

(→‎Sequence and Features)
(→‎Theoretical Part Design)
 
(8 intermediate revisions by one other user not shown)
Line 12: Line 12:
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
−
We placed the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) downstream behind graR. This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.
+
This part was codon-optimized for human cell lines and was synthesized.
−
 
+
−
<html>
+
−
 
+
−
+
−
 
+
−
  <head>
+
−
 
+
−
      <title>HTML Table Caption</title>
+
−
 
+
−
  </head>
+
−
 
+
−
+
−
 
+
−
<body>
+
−
 
+
−
<caption>Table1: Primers used to extract the graR gene sequence.</caption>
+
−
 
+
−
<table style="width:70%">
+
−
 
+
−
  <tr>
+
−
 
+
−
    <th>Primer name</th>
+
−
 
+
−
    <th>Sequence</th>
+
−
 
+
−
  </tr>
+
−
 
+
−
  <tr>
+
−
 
+
−
    <td>graR_fw_1</td>
+
−
 
+
−
    <td>TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt</td>
+
−
 
+
−
  </tr>
+
−
 
+
−
  <tr>
+
−
 
+
−
    <td>graR_rv_1</td>
+
−
 
+
−
    <td>tggatccccttcatgagccatatatccttttcctacttttgt</td>
+
−
 
+
−
  </tr>
+
−
 
+
−
</table>
+
−
 
+
−
</body>
+
−
+
−
 
+
−
+
−
 
+
−
</html>
+
  
 
===Sequence and Features===
 
===Sequence and Features===
Line 70: Line 19:
 
<partinfo>BBa_K5317015 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5317015 SequenceAndFeatures</partinfo>
  
−
===References===
+
=Characterization=  
 +
 
 +
The GraR functionality was analyzed by composing a gene cassette fused with the reporter gene mRuby2  <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span> to assess GraR cell localization based on the fluorescent signal with unstimulated ampicillin conditions. Please visit the <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317020 K5317020]</span> registry entry to view the results.
 +
 
 +
=References=
 
El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. <i>Nature Chemical Biology</i>, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8
 
El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. <i>Nature Chemical Biology</i>, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8
  
Line 78: Line 31:
  
 
Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. <I> Infection and Immunity</i>, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11
 
Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. <I> Infection and Immunity</i>, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11
−
 
−
<!-- Uncomment this to enable Functional Parameter display
 
−
===Functional Parameters===
 
−
<partinfo>BBa_K5317015 parameters</partinfo>
 
−
<!-- -->
 

Latest revision as of 20:31, 1 October 2024


GraR

Usage and Biology

GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporters (El-Halfawy et al., 2020; Yang et al., 2012; Meehl et al., 2007). The GraSR system is a two-component regulatory system that controls the expression of many genes involved in stress response, cell wall metabolism and virulence pathways in Staphylococcus aureus (Falord et al., 2011).

Accordingly, GraR functions as a transcription factor and our cell-based antiobiotics sensor utilises it as such by aiming for its PknB-dependent phyosphorylation (K5317013).

Cloning

Theoretical Part Design

This part was codon-optimized for human cell lines and was synthesized.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 235
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 235
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 235
  • 1000
    COMPATIBLE WITH RFC[1000]

Characterization

The GraR functionality was analyzed by composing a gene cassette fused with the reporter gene mRuby2 K5317001 to assess GraR cell localization based on the fluorescent signal with unstimulated ampicillin conditions. Please visit the K5317020 registry entry to view the results.

References

El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. Nature Chemical Biology, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8

Falord, M., Mäder, U., Hiron, A., Débarbouillé, M., & Msadek, T. (2011). Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways. PLoS ONE, 6(7), e21323. https://doi.org/10.1371/journal.pone.0021323

Meehl, M., Herbert, S., Götz, F., & Cheung, A. (2007). Interaction of the GraRS Two-Component System with the VraFG ABC Transporter To Support Vancomycin-Intermediate Resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy , 51(8), 2679–2689. https://doi.org/10.1128/AAC.00209-07

Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. Infection and Immunity, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11