Difference between revisions of "Part:BBa K5317014"

 
(8 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K5317014 short</partinfo>
 
<partinfo>BBa_K5317014 short</partinfo>
Line 5: Line 4:
 
===Usage and Biology===
 
===Usage and Biology===
  
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. This phosphorylation-dependent mechanism enables ''S. aureus'' to adapt to different environmental conditions, thereby increasing its survivability and virulence (Liao ''et al.'', 2022). We used this bacterial protein to evaluate the interaction with the PknB kinase.
+
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. This phosphorylation-dependent mechanism enables ''S. aureus'' to adapt to different environmental conditions, thereby increasing its survivability and virulence (Liao ''et al.'', 2022). We used this mechanism of ccpA to evaluate the interaction with the PknB kinase when stimulated with ß-lactam antibiotics.
  
 
=Cloning=
 
=Cloning=
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
This part was codon optimised for human cell lines. This part was amplified by using the primers in table 1.
+
This part was codon-optimized and synthesized for expression in human cell lines.
  
<html>  
+
===Sequence and Features===
 +
<partinfo>BBa_K5317014 SequenceAndFeatures</partinfo>
  
+
=Characterization=
  
  <head>
+
The correct ccpA functionality was analyzed by composing a gene cassette that is placed downstream of the constitutive CMV promoter and fused with the reporter gene mRuby2 to assess by indication with ß-lactam antibiotics the ccpA localization based on the fluorescent signal. Please visit the <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317019 K5317019]</span> registry entry to view the results.
 
+
      <title>HTML Table Caption</title>
+
 
+
  </head>
+
 
+
+
 
+
<body>
+
 
+
<caption>Table1: Primers used to extract the ccpA gene sequence.</caption>
+
 
+
<table style="width:70%">  
+
 
+
  <tr>
+
 
+
    <th>Primer name</th>
+
 
+
    <th>Sequence</th>
+
 
+
  </tr>
+
 
+
  <tr>
+
 
+
    <td>ccpA_fw_1</td>
+
 
+
    <td>tggatccccttttgtagttcctcggtattcaattctgtgag</td>
+
 
+
  </tr>
+
 
+
  <tr>
+
 
+
    <td>ccpA_rv</td>
+
 
+
    <td>TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc</td>
+
 
+
  </tr>
+
 
+
</table>
+
 
+
</body>
+
+
 
+
+
 
+
</html>
+
 
+
 
+
===Sequence and Features===
+
<partinfo>BBa_K5317014 SequenceAndFeatures</partinfo>
+
  
===References===
 
  
 +
=References=
  
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587

Latest revision as of 22:07, 1 October 2024

CcpA

Usage and Biology

The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. This phosphorylation-dependent mechanism enables S. aureus to adapt to different environmental conditions, thereby increasing its survivability and virulence (Liao et al., 2022). We used this mechanism of ccpA to evaluate the interaction with the PknB kinase when stimulated with ß-lactam antibiotics.

Cloning

Theoretical Part Design

This part was codon-optimized and synthesized for expression in human cell lines.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Characterization

The correct ccpA functionality was analyzed by composing a gene cassette that is placed downstream of the constitutive CMV promoter and fused with the reporter gene mRuby2 to assess by indication with ß-lactam antibiotics the ccpA localization based on the fluorescent signal. Please visit the K5317019 registry entry to view the results.


References

Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587