Latest revision as of 08:22, 30 September 2024

siHSP70-3

Sequence and Features

Origin

Synthesized by company.

Properties

Inhibition of Heat Shock Protein 70 expression.

Usage and Biology

siHSP70-3 inhibits the target gene HSP70 as a small interfering RNA (siRNA). HSP70 can induce IgE-mediated hypersensitivity reactions and T-cell responses in allergic individuals (Fagotti et al., 2022). Further discussion of it as a pan-allergen can be found in part BBa_K2619011. siRNA is a key component of the RNAi process, a powerful gene silencing mechanism. Once introduced into the target cells, it is recognized and loaded into the RNA-Induced Silencing Complex (RISC). The siRNA’s antisense strand binds to the complementary target mRNA molecule, triggering the RISC complex to cleave the target mRNA, preventing translation into a functional protein (Agrawal et al., 2003). The silencing effect typically lasts around 12 days.

siHSP70-3 is particularly useful in plant cells, where it successfully inhibits the expression of the pan-allergen HSP70, reducing allergic symptoms related to *Populus tomentosa* pollen allergy.

Cultivation and Purification

The part sequence we have registered is its corresponding DNA sequence, which needs to be transcribed into RNA sequence for use. The following sequences are siRNA sequences.

siHSP70-3 is synthesized through oligonucleotides with a nucleic acid synthesizer. The following sequences represent the sense and antisense strands of the siRNA:

- Oligo Sequence for siHSP70-3-SS: CCAUGUACCUCACCAAGAUGC

- Oligo Sequence for siHSP70-3-AS: AUCUUGGUGAGGAUCAUGGAG

These oligonucleotides are then annealed to form a double-stranded siRNA molecule. The siRNA is purified using high-performance liquid chromatography (HPLC) (Sohail et al., 2003). To enhance delivery into plant cells, carbon dots (CDs) were incorporated with Polyethyleneimine (PEI) through the microwave method, allowing the negatively charged siRNA to bind to the CDs.

Measurement and Characterization

In this project, we utilized RT-qPCR technology to assess the expression levels of the target gene. We employed a relative quantification method that standardizes the expression of the target gene across different samples using a reference gene. Specifically, we compared the Ct values of the target gene in experimental samples with those in control samples, with the results expressed as the ratio or fold change in the target gene expression between the experimental and control samples.

In our experiments, we selected β-actin as the reference gene for normalization. By normalizing the expression levels, we derived the fold change of the target gene expression in the experimental samples relative to the control samples. The normalized expression level of the target gene in the control samples was set to "1", while the normalized expression levels in the experimental samples were reported as the fold increase or decrease compared to the control. This calculation was performed using the 2^-(∆∆Ct) method, which effectively reflects the relative expression levels of the target gene across different samples.

Figure 1. RT-qPCR results for protoplasts.

Figure 1 shows the effect of siHSP70-3 on inhibiting HSP70 expression. The results showed that siHSP70-3 reduced the expression level of HSP70 by 30%. Although siRNA-3 is successful, its efficiency needs to be optimized.

Figure 2. RT-qPCR results for tobacco leaf injection.

RT-qPCR results for siRNA injection in tobacco leaves. siHSP70-3, particularly when combined with CDs, demonstrated great success in repressing HSP70 expression to the lowest level observed.

Figure 3. RT-qPCR results for osmanthus tree trunk injection.

RT-qPCR results for siRNA delivery through trunk injection in osmanthus trees. siHSP70-3, when combined with CDs, showed the most success in inhibiting HSP70 expression compared to other siRNAs, though the extent of repression could still be improved.

Further trials are needed to verify efficacy.

Reference

Agrawal N. N., Dasaradhi P. V., Mohmmed A., Malhotra P., Bhatnagar R. K., & Mukherjee S. K. (2003). RNA Interference: Biology, Mechanism, and Applications. *Microbiology and Molecular Biology Reviews*, 67(4), 657-685. [1](https://doi.org/10.1128/MMBR.67.4.657-685.2003)

Fagotti A., Lucentini L., Simoncelli F., La Porta G., Brustenga L., Bizzarri I., Trio S., Isidori C., Di Rosa I., & Di Cara G. (2022). HSP70 upregulation in nasal mucosa of symptomatic children with allergic rhinitis and potential risk of asthma development. *Scientific Reports*, 12(1), 1-10. [2](https://doi.org/10.1038/s41598-022-18443-x)

Sohail M., Doran G., Riedemann J., Macaulay V., & Southern E. M. (2003). A simple and cost-effective method for producing small interfering RNAs with high efficacy. *Nucleic Acids Research*, 31(7), e38.