Difference between revisions of "Part:BBa K5267002"
(→‎Profile)
 
(5 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
<partinfo>BBa_K5267002 short</partinfo>
 
<partinfo>BBa_K5267002 short</partinfo>
  
−
GPCRs
+
<p> The mammalian MT2 melatonin receptor is classified as a G protein-coupled receptor (GPCR) and plays a crucial role in regulating circadian rhythms and sleep-wake cycles by responding to melatonin, a hormone produced by the pineal gland.Notably, the melatonin receptors MT1 and MT2 exhibit variations in the conformational attributes of specific secondary structural components, particularly within the helical regions and loop domains. A significant example of this is the second extracellular loop (ECL2), whose conformation differs markedly between the two receptor isoforms. This divergence in ECL2 is thought to be a pivotal factor contributing to the differential ability of MT1 to engage downstream Gq/11 proteins, a functional characteristic that MT2 lacks. Such structural disparities are believed to manifest in the distinct functional repertoires of MT1 and MT2, underscoring the importance of these subtle conformational variations in dictating receptor functionality.</p>
−
 
+
<p>Upon activation by melatonin, the MT2 receptor triggers several intracellular signaling pathways, including the cAMP-PKA pathway and the cGMP-PKG signaling pathway. These pathways influence gene expression related to various cellular processes, such as metabolism, growth, and apoptosi</p>
−
<!-- Add more about the biology of this part here
+
−
===Usage and Biology===
+
  
 
<!-- -->
 
<!-- -->
−
<span class='h3bb'>Sequence and Features</span>
+
==Sequence and Features==
 
<partinfo>BBa_K5267002 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5267002 SequenceAndFeatures</partinfo>
  
Line 17: Line 15:
 
<!-- -->
 
<!-- -->
  
−
===Profile===
+
==Profile==
 
Name: MTNR1B
 
Name: MTNR1B
 
<br>Pairs: 1089bp
 
<br>Pairs: 1089bp
 
<br>Origin: Homo sapiens
 
<br>Origin: Homo sapiens
−
<br>Properties: GPCRs
+
<br>Properties: A GPCR that responds to melatonin
 +
<br>Short description: MTNR1B
 +
<br>Full description: The part encodes a 7-transmembrane melatonin receptor MTNR1B, which responses to melatonin.
  
 +
==Usage and Biology==
 +
<p> MT2 (melatonin receptor type 2) is an integral membrane protein classified as a G protein-coupled receptor (GPCR) and features a seven-transmembrane domain structure. It is predominantly located in the retina and brain, where it is believed to participate in light-dependent functions within the retina and may be involved in the neurobiological effects of melatonin.[1] </p>
  
−
===Usage and Biology===
+
<p> Unlike the distribution of MT1, MT2 is primarily found in brain regions that regulate non-rapid eye movement (NREM) sleep, such as the reticular nucleus of the thalamus, as well as in areas that control sleep homeostasis, including the cortex and the ventrolateral preoptic nucleus (VLPO).</p>
−
MT2(melatonin receptor type 2) is an integral membrane protein that is a G protein coupled receptor (GPCR), 7-transmembrane receptor. It is found primarily in the retina and brain. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin.<sup>[1]</sup>
+
 
−
MT2 has been reported to modulate many physiological processes, especially those related to sleep and circadian rhythm regulation, but also in retina physiology, pain and neuronal and immune functions.
+
<p> In the human body, melatonin (N-acetyl-5-methoxytryptamine) is a widespread neurohormone with roles in the regulation of circadian rhythms, antioxidative protection, and various other functions. Melatonin binds with high affinity to the ligand-binding pocket of melatonin receptors, including MT2. This binding event activates downstream signaling pathways that influence gene expression related to various cellular processes[2]. </p>
 +
 
 +
<p>The figure from Okamoto, H. H. (2024) illustrates the overall structure of MT2 in both its activated and inactivated forms. It also shows the position of the ligand-binding pocket of MT2, where melatonin binds to initiate receptor activation and subsequent downstream signaling[2].</p>
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
−
<div style="width=100%;height=auto;align-items:center">
+
<div style="width=100%; height=auto; text-align: center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/4.jpg" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/runtimeerror/mtnr1b-1.png" class="figure-img img-fluid rounded"  height="800px">
−
 
+
</div>
 +
</figure>
 
</html>
 
</html>
  
−
<br>Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. <sup>[3]</sup>
+
<p> Figure 1: Overall structures of MT2 (A: inactive state [PDB ID: 6ME6], D: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (B) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (C) Overall TM6 movement during receptor activation of MT2 (inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (F) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3] </p>
  
−
 
+
<p> As a member of the GPCR family, MT2 primarily transmits signals through G protein coupling. Specifically, MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein (CREB) by activating Gαi/o proteins, which inhibit intracellular adenylyl cyclase (AC) activity and reduce intracellular cAMP concentration. Additionally, MT2 inhibits the activity of guanylyl cyclase (GC), thereby decreasing intracellular cGMP concentration and regulating cGMP-dependent signaling pathways. Furthermore, MT2 can regulate gene expression by coupling with Gαq/11 proteins to activate phospholipase C (PLC), increase intracellular Ca²⁺ levels, and activate the protein kinase C (PKC) pathway, promoting downstream signal transduction.[4].The figure from Okamoto, H. H (2024) depicts melatonin receptor-mediated signal transduction.</p>
−
===Signal transduction features===
+
−
As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [2]
+
−
<br>In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
+
−
<br>The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)
+
  
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
−
<div style="width=100%;height=auto">
+
<div style="width=100%; height=auto; text-align: center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/5.png" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/vetsci-09-00309-g002.png" class="figure-img img-fluid rounded"  height="500px">
 +
</div>
 +
</figure>
  
 
</html>
 
</html>
−
<br>Figure 1. Melatonin receptor signaling pathways. [3]
 
−
===Function test===
 
−
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
 
−
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 
  
 +
<p> '''Figure 2. Melatonin receptor signaling pathways [4].''' </p>
 +
 +
 +
==Reference==
 +
<p> [1] N. database, "Gene [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2024 Sep 01]. Available from: https://www.ncbi.nlm.nih.gov/gene/," 2004. </p>
  
−
===Sequence===
+
<p> [2] H. H. Okamoto, E. Cecon, O. Nureki, S. Rivara, and R. Jockers, “Melatonin receptor structure and signaling,” Journal of Pineal Research, vol. 76, no. 3, 2024. </p>
−
Top:
+
−
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
+
−
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
+
−
<br>CAGTACT
+
  
 +
<p> [3] Y. Gao, S. Zhao, Y. Zhang, and Q. Zhang, “Melatonin Receptors: A Key Mediator in Animal Reproduction,” Vet. Sci., vol. 9, no. 7, p. 309, Jun. 2022, doi: 10.3390/vetsci9070309. </p>
  
−
===Reference===
+
<p> [4] “Melatonin receptor structure and signaling,” J. Pineal Res., vol. 76, no. 3, p. e12952, Apr. 2024, doi: 10.1111/jpi.12952. </p>
−
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
+
−
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
+
−
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.
+

Latest revision as of 09:31, 2 October 2024

Mammalian MT2 melatonin receptor

The mammalian MT2 melatonin receptor is classified as a G protein-coupled receptor (GPCR) and plays a crucial role in regulating circadian rhythms and sleep-wake cycles by responding to melatonin, a hormone produced by the pineal gland.Notably, the melatonin receptors MT1 and MT2 exhibit variations in the conformational attributes of specific secondary structural components, particularly within the helical regions and loop domains. A significant example of this is the second extracellular loop (ECL2), whose conformation differs markedly between the two receptor isoforms. This divergence in ECL2 is thought to be a pivotal factor contributing to the differential ability of MT1 to engage downstream Gq/11 proteins, a functional characteristic that MT2 lacks. Such structural disparities are believed to manifest in the distinct functional repertoires of MT1 and MT2, underscoring the importance of these subtle conformational variations in dictating receptor functionality.

Upon activation by melatonin, the MT2 receptor triggers several intracellular signaling pathways, including the cAMP-PKA pathway and the cGMP-PKG signaling pathway. These pathways influence gene expression related to various cellular processes, such as metabolism, growth, and apoptosi

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: MTNR1B
Pairs: 1089bp
Origin: Homo sapiens
Properties: A GPCR that responds to melatonin
Short description: MTNR1B
Full description: The part encodes a 7-transmembrane melatonin receptor MTNR1B, which responses to melatonin.

Usage and Biology

MT2 (melatonin receptor type 2) is an integral membrane protein classified as a G protein-coupled receptor (GPCR) and features a seven-transmembrane domain structure. It is predominantly located in the retina and brain, where it is believed to participate in light-dependent functions within the retina and may be involved in the neurobiological effects of melatonin.[1]

Unlike the distribution of MT1, MT2 is primarily found in brain regions that regulate non-rapid eye movement (NREM) sleep, such as the reticular nucleus of the thalamus, as well as in areas that control sleep homeostasis, including the cortex and the ventrolateral preoptic nucleus (VLPO).

In the human body, melatonin (N-acetyl-5-methoxytryptamine) is a widespread neurohormone with roles in the regulation of circadian rhythms, antioxidative protection, and various other functions. Melatonin binds with high affinity to the ligand-binding pocket of melatonin receptors, including MT2. This binding event activates downstream signaling pathways that influence gene expression related to various cellular processes[2].

The figure from Okamoto, H. H. (2024) illustrates the overall structure of MT2 in both its activated and inactivated forms. It also shows the position of the ligand-binding pocket of MT2, where melatonin binds to initiate receptor activation and subsequent downstream signaling[2].

Figure 1: Overall structures of MT2 (A: inactive state [PDB ID: 6ME6], D: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (B) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (C) Overall TM6 movement during receptor activation of MT2 (inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (F) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3]

As a member of the GPCR family, MT2 primarily transmits signals through G protein coupling. Specifically, MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein (CREB) by activating Gαi/o proteins, which inhibit intracellular adenylyl cyclase (AC) activity and reduce intracellular cAMP concentration. Additionally, MT2 inhibits the activity of guanylyl cyclase (GC), thereby decreasing intracellular cGMP concentration and regulating cGMP-dependent signaling pathways. Furthermore, MT2 can regulate gene expression by coupling with Gαq/11 proteins to activate phospholipase C (PLC), increase intracellular Ca²⁺ levels, and activate the protein kinase C (PKC) pathway, promoting downstream signal transduction.[4].The figure from Okamoto, H. H (2024) depicts melatonin receptor-mediated signal transduction.

Figure 2. Melatonin receptor signaling pathways [4].


Reference

[1] N. database, "Gene [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2024 Sep 01]. Available from: https://www.ncbi.nlm.nih.gov/gene/," 2004.

[2] H. H. Okamoto, E. Cecon, O. Nureki, S. Rivara, and R. Jockers, “Melatonin receptor structure and signaling,” Journal of Pineal Research, vol. 76, no. 3, 2024.

[3] Y. Gao, S. Zhao, Y. Zhang, and Q. Zhang, “Melatonin Receptors: A Key Mediator in Animal Reproduction,” Vet. Sci., vol. 9, no. 7, p. 309, Jun. 2022, doi: 10.3390/vetsci9070309.

[4] “Melatonin receptor structure and signaling,” J. Pineal Res., vol. 76, no. 3, p. e12952, Apr. 2024, doi: 10.1111/jpi.12952.