Difference between revisions of "Part:BBa K5107006"
(→Sequence and Features) |
|||
(13 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
__NOTOC__ | __NOTOC__ | ||
− | <partinfo> | + | <partinfo>BBa_K5107006 short</partinfo> |
− | + | T7-HRE5-dB-T is a construct used by the cell free biosensor.The HRE5 is recognised by the steroid androgen, progenesterone and glycocorticoid hormone receptor. Then in vitro transcription of the dimeric broccoli is taken place if the hormone is present or not in the cell free solution. | |
+ | ===Usage and Biology=== | ||
+ | For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor<html><a href="#ref1">[1]</a></html>, modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements. The exact parts are described here: | ||
+ | <center><html><img src="https://static.igem.wiki/teams/5107/eng-parts-re5.webp"width="600" height="200"> | ||
+ | <figcaption><b>Figure 1:</b> Overview of the T7-HRE5-dB-T and T7-ERE5-dB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.</figcaption></html></center>. | ||
+ | ==Cell free biosensor== | ||
+ | This is the principal function of our desinged biosensor | ||
+ | <html> | ||
+ | <center> | ||
+ | <div style="display: flex; justify-content: center;"> | ||
+ | <figure> | ||
+ | <img src="https://static.igem.wiki/teams/5107/eng-cellfreesystem-p1.webp" height="300" alt="Cell-Free System Part 1"> | ||
+ | <figcaption><b>Figure 2:</b> Cell-Free System - No Hormone/EDC in the environment.</figcaption> | ||
+ | </figure> | ||
+ | <figure style="margin-left: 20px;"> | ||
+ | <img src="https://static.igem.wiki/teams/5107/eng-cellfreesystem-p2.webp" height="300" alt="Cell-Free System Part 2"> | ||
+ | <figcaption><b>Figure 3:</b> Cell-Free System - Hormone/EDC in the environment.</figcaption> | ||
+ | </figure> | ||
+ | </div> | ||
+ | </center> | ||
+ | </html> | ||
+ | '''When no EDC is present'''(Figure 2), the receptor will not bind the DNA, and thus the T7 RNAP is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm. | ||
+ | '''When an EDC is present'''(Figure 3), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter. | ||
+ | |||
+ | |||
+ | ==Assemply== | ||
+ | We used USER cloning to assemble the T7-HRE5-dB-T and T7-ERE5-dB-T. For the design of the assembly we used the AMUSER tool <html><a href='https://services.healthtech.dtu.dk/services/AMUSER-1.0/'>https://services.healthtech.dtu.dk/services/AMUSER-1.0/</a></html>. | ||
+ | The USER assembly consists of 2 steps - PCR and the USER reaction. | ||
+ | *First, we ran PCR reactions using primers from the AMUSER tool for the following parts: | ||
+ | |||
+ | #pUC19-T7-3WJdB-T(plasmid was a gift from Donald Burke (Addgene plasmid # 87308 ; http://n2t.net/addgene:87308 ; RRID:Addgene_87308))<html><a href="#ref2">[2]</a></html> | ||
+ | #HRE5 ([https://parts.igem.org/Part:BBa_K5107002 BBa_K5107002]) | ||
+ | #ERE5 ([https://parts.igem.org/Part:BBa_K5107004 BBa_K5107004]) | ||
+ | |||
+ | Each of the primers used to amplify a given response element part (HRE5, ERE5) was equipped with a specific USER overhang, complementary to the overhangs produced in plasmid backbone (pUC19-T7-3WJdB-T). For the PCRs, a Phusion U Hot Start polymerase that tolerates uracil bases was used. As a result, we obtained PCR products ready for USER cloning procedure. | ||
+ | |||
+ | |||
+ | *USER cloning | ||
+ | |||
+ | USER cloning is a uracil-based excision technique that utilizes USER (Uracil-Specific Excision Reagent) enzyme to create specific 3’-overhangs on a DNA template. PCR products with double-strand USER overhangs (each containing uracil base) are subdued to the activity of USER and DpnI enzymes, resulting in an assembly of complementary overhangs and ligation of the templates.In our case, each of the responsive elements (HRE5, ERE5) was cloned into a backbone plasmid pUC19-T7-3WJdB-T. As a result, we produced two plasmids: | ||
+ | |||
+ | #pUC19-T7-HRE5-3WJdB-T (pUC19_HRE5) | ||
+ | #pUC19-T7-ERE5-3WJdB-T (pUC19_ERE5) | ||
+ | |||
+ | |||
+ | *Validation | ||
+ | {| class="wikitable" | ||
+ | |+ Primers for IVT Template | ||
+ | |- | ||
+ | ! !! Forward Primer !! Reverse Primer | ||
+ | |- | ||
+ | | IVT Template || gcggataacaatttcacacaggaaacagc || caaaaaacccctcaagacccg | ||
+ | |} | ||
+ | ''Table 1: Primer for IVT template amplification'' | ||
+ | |||
+ | Each plasmid was transformed into and amplified in E. coli strain DH5-α. The final IVT templates (T7-HRE5-dB-T and T7-ERE5-dB-T) were obtained by PCR of the target sequences containing only the DNA parts necessary for Cell-Free Transcription System(Table 1).Here it is shown only the gel electrophoresis of the T7-HRE5-dB-T. | ||
+ | <html> | ||
+ | <center> | ||
+ | <figure> | ||
+ | <img src="https://static.igem.wiki/teams/5107/parts/pcr-re5.webp" height="300" alt="PCR validation of the ROSALIND templates"> | ||
+ | <figcaption><b>Figure 4:</b> PCR validation of the cell free biosensor template(T7-HRE5-dB-T).</figcaption> | ||
+ | </figure> | ||
+ | </center> | ||
+ | </html> | ||
+ | |||
+ | ==Test and Optimization== | ||
+ | |||
+ | To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly. | ||
+ | Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II). | ||
+ | |||
+ | 1. '''Wavelength and Plate reader setting''' | ||
+ | *Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings. | ||
+ | |||
+ | *Result:Higher fluorescence output was yielded by: | ||
+ | Using the wavelength couple 488/530 nm. | ||
+ | Reading from the top (instead from the bottom) | ||
+ | |||
+ | <html> | ||
+ | <center> | ||
+ | <figure> | ||
+ | <img src="https://static.igem.wiki/teams/5107/parts/wavelength-comparison-dark.webp" height="300" alt=""> | ||
+ | <figcaption><b>Figure 5:</b> Wavelength optimization.Fluorescein sodium salt was used as reference.</figcaption> | ||
+ | </figure> | ||
+ | </center> | ||
+ | </html> | ||
+ | 2. '''Buffer test''' | ||
+ | *Rationale: Optimize the reaction to increase the signal | ||
+ | |||
+ | Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer. | ||
+ | |||
+ | *Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made. | ||
+ | When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this, is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it. | ||
+ | |||
+ | 3. '''DNA concentration''' | ||
+ | *Rationale: Increase the sensitivity of the biosensor, enlarge the limits of detection, and reduce the cost of testing. | ||
+ | Reducing the amount of DNA enhances both sensitivity and the limit of detection, which are critical factors for our stakeholders. This reduction will ultimately lower the detection threshold, allowing even trace amounts of EDCs in the tested water to produce measurable inhibition. Additionally, it enables us to minimize the use of the receptor, the most expensive component of the biosensor system. | ||
+ | *Results: A concentration of 10 nM of DNA was sufficient to yield a substantial signal and the best one to perform the next experiments, also according to the Modeling analysis. | ||
+ | |||
+ | <html> | ||
+ | <center> | ||
+ | <figure> | ||
+ | <img src="https://static.igem.wiki/teams/5107/parts/dna-comparison-narrow-dark.webp" height="300"alt=""> | ||
+ | <figcaption><b>Figure 6:</b> Test for different DNA concentrations in order to have a readable and measurable signal. Measurements were taken after 1 hour for 20 minutes. Error bars represent standard deviation of triplicates.</figcaption> | ||
+ | </figure> | ||
+ | </center> | ||
+ | </html> | ||
+ | We didn’t test for lower DNA concentration, as, for the first iteration, it was not recommended by the initial Modeling analysis with the data from literature (see [https://2024.igem.wiki/dtu-denmark/model]). | ||
− | |||
===Sequence and Features=== | ===Sequence and Features=== | ||
− | <partinfo> | + | <partinfo>BBa_K5107006 SequenceandFeatures</partinfo> |
Line 18: | Line 123: | ||
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
===Functional Parameters=== | ===Functional Parameters=== | ||
− | <partinfo> | + | <partinfo>BBa_K5107006 parameters</partinfo> |
<!-- --> | <!-- --> | ||
===References=== | ===References=== | ||
+ | <html> | ||
+ | <ol> | ||
+ | <li id="ref1"> | ||
+ | Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). | ||
+ | <i>Nature Biotechnology</i>, <i>38</i>(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7 | ||
+ | </li> | ||
+ | <li id="ref2"> | ||
+ | Alam, K. K., Tawiah, K. D., Lichte, M. F., Porciani, D., & Burke, D. H. (2017). A Fluorescent Split Aptamer for Visualizing RNA–RNA Assembly In Vivo. ACS Synthetic Biology, 6(9), 1710–1721. https://doi.org/10.1021/acssynbio.7b00059 | ||
+ | </li> | ||
+ | </ol> | ||
+ | </html> |
Latest revision as of 12:21, 30 September 2024
T7-HRE5-dB-T
T7-HRE5-dB-T is a construct used by the cell free biosensor.The HRE5 is recognised by the steroid androgen, progenesterone and glycocorticoid hormone receptor. Then in vitro transcription of the dimeric broccoli is taken place if the hormone is present or not in the cell free solution.
Usage and Biology
For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor[1], modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements. The exact parts are described here:
Cell free biosensor
This is the principal function of our desinged biosensor
Assemply
We used USER cloning to assemble the T7-HRE5-dB-T and T7-ERE5-dB-T. For the design of the assembly we used the AMUSER tool https://services.healthtech.dtu.dk/services/AMUSER-1.0/. The USER assembly consists of 2 steps - PCR and the USER reaction.
- First, we ran PCR reactions using primers from the AMUSER tool for the following parts:
- pUC19-T7-3WJdB-T(plasmid was a gift from Donald Burke (Addgene plasmid # 87308 ; http://n2t.net/addgene:87308 ; RRID:Addgene_87308))[2]
- HRE5 (BBa_K5107002)
- ERE5 (BBa_K5107004)
Each of the primers used to amplify a given response element part (HRE5, ERE5) was equipped with a specific USER overhang, complementary to the overhangs produced in plasmid backbone (pUC19-T7-3WJdB-T). For the PCRs, a Phusion U Hot Start polymerase that tolerates uracil bases was used. As a result, we obtained PCR products ready for USER cloning procedure.
- USER cloning
USER cloning is a uracil-based excision technique that utilizes USER (Uracil-Specific Excision Reagent) enzyme to create specific 3’-overhangs on a DNA template. PCR products with double-strand USER overhangs (each containing uracil base) are subdued to the activity of USER and DpnI enzymes, resulting in an assembly of complementary overhangs and ligation of the templates.In our case, each of the responsive elements (HRE5, ERE5) was cloned into a backbone plasmid pUC19-T7-3WJdB-T. As a result, we produced two plasmids:
- pUC19-T7-HRE5-3WJdB-T (pUC19_HRE5)
- pUC19-T7-ERE5-3WJdB-T (pUC19_ERE5)
- Validation
Forward Primer | Reverse Primer | |
---|---|---|
IVT Template | gcggataacaatttcacacaggaaacagc | caaaaaacccctcaagacccg |
Table 1: Primer for IVT template amplification
Each plasmid was transformed into and amplified in E. coli strain DH5-α. The final IVT templates (T7-HRE5-dB-T and T7-ERE5-dB-T) were obtained by PCR of the target sequences containing only the DNA parts necessary for Cell-Free Transcription System(Table 1).Here it is shown only the gel electrophoresis of the T7-HRE5-dB-T.
Test and Optimization
To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly. Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II).
1. Wavelength and Plate reader setting
- Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings.
- Result:Higher fluorescence output was yielded by:
Using the wavelength couple 488/530 nm. Reading from the top (instead from the bottom)
- Rationale: Optimize the reaction to increase the signal
Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer.
- Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made.
When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this, is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it.
3. DNA concentration
- Rationale: Increase the sensitivity of the biosensor, enlarge the limits of detection, and reduce the cost of testing.
Reducing the amount of DNA enhances both sensitivity and the limit of detection, which are critical factors for our stakeholders. This reduction will ultimately lower the detection threshold, allowing even trace amounts of EDCs in the tested water to produce measurable inhibition. Additionally, it enables us to minimize the use of the receptor, the most expensive component of the biosensor system.
- Results: A concentration of 10 nM of DNA was sufficient to yield a substantial signal and the best one to perform the next experiments, also according to the Modeling analysis.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 72
Illegal PstI site found at 60 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 60
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 72
Illegal PstI site found at 60 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 72
Illegal PstI site found at 60 - 1000COMPATIBLE WITH RFC[1000]
References
- Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). Nature Biotechnology, 38(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7
- Alam, K. K., Tawiah, K. D., Lichte, M. F., Porciani, D., & Burke, D. H. (2017). A Fluorescent Split Aptamer for Visualizing RNA–RNA Assembly In Vivo. ACS Synthetic Biology, 6(9), 1710–1721. https://doi.org/10.1021/acssynbio.7b00059