Difference between revisions of "Part:BBa K5143003"
Perrine-fdn (Talk | contribs) |
|||
(3 intermediate revisions by 2 users not shown) | |||
Line 13: | Line 13: | ||
<h1>Construction</h1> | <h1>Construction</h1> | ||
<p> | <p> | ||
− | The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. <br> | + | The codons were optimised for synthesis and expression in <I> Saccharomyces cerevisiae </I>. <br> |
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br> | MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br> | ||
− | This composite part is part of the following larger composite part: | + | This composite part is part of the following larger composite part: <a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a> <br> |
It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a> | It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a> | ||
</p> | </p> | ||
Line 24: | Line 24: | ||
</body> | </body> | ||
</html> | </html> | ||
+ | <!-- Add more about the biology of this part here | ||
+ | ===Usage and Biology=== | ||
+ | |||
+ | <!-- --> | ||
+ | <h1>Sequence and Features</h1> | ||
+ | <partinfo>BBa_K5143003 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | <!-- Uncomment this to enable Functional Parameter display | ||
+ | ===Functional Parameters=== | ||
+ | <partinfo>BBa_K5143003 parameters</partinfo> | ||
+ | <!-- --> |
Latest revision as of 20:59, 14 August 2024
Description
Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²
![Cp19k-MaSp1](https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png)
Construction
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: BBa_K5143024
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005
References
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 577
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 1000COMPATIBLE WITH RFC[1000]