Difference between revisions of "Part:BBa K5133004"

Latest revision as of 14:57, 29 July 2024

sfGFP generator for CFPS (cell-free protein synthesis)

Group: GEC-China (iGEM 2024, team number: #5133)

Introduction

This composite part is derived from plasmid pJL1 (Addgene: #69496)^[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of superfolder green fluorescent protein (sfGFP, BBa_K5133002), and T7 terminator (BBa_K5133003)(Figures 1, 2). The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)^[2], however, an iGEM-standarized CFPS construction has not yet been commonly reported and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.

Results

For the characterization process of this part, follow five steps showing in Figure 3: (1) molecular cloning; (2) colony PCR; (3) sequencing; (4) plasmid extraction; (5) CFPS reaction.

Step 1: molecular cloning

To construct this part, we first need to acquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inserted fragments by using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (Figure 4) as pSB1C3 (2070 bp) and inserted fragment (988 bp) used in this construction.

When we got the purified DNA products, then we assembled these fragments by using Gibson Assembly strategy^[3]. Next, we transformed the reaction to competent E. coli Mach1-T1 cells and spread the transformants onto LB-agar plates containing 34 µg/mL chloramphenicol. As shown in Figure 5, the E. coli transformants could normally grow on LB-agar plates and be used for the following experiments.

Step 2: colony PCR

To verify the constructions, we next performed colony PCR by using the reported protocol^[4]. For each construction (not only this part, but also BBa_K5133006 and BBa_K5133008), we selected four independent colonies from LB-agar plates and used primer pair VF2/VR to amplify the inserted DNA sequences. After that, we analyzed the DNA products by agarose gel electrophoresis. Results show that four PCR products match the desired DNA sizes of this construction (Figure 6).

Step 3: sequencing

Consequently, we picked the desired PCR products for sequencing. Results of Sanger sequencing show the successful construction of this part (Figure 7), which means that the plasmid could be used for the following experiments.

Step 4: plasmid extract

After we acquired the correct plasmids, we then tried to extract and purify the plasmids for the following CFPS reactions. By using the plasmid extract kit, we gained the purified plasmids and analyzed them by agarose gel electrophoresis. Results in Figure 8 show that the extracted plasmids are clean, consisting of two conformations: linear and supercoiled^[5]. To further evaluate the plasmid sizes, we digested the three plasmids by EcoRI (restriction enzyme). After digestion, the three plasmids show the expected linearized comformation and match the desired DNA sizes. These results indicate the successful construction and extraction of this composite part.

Step 5: CFPS reaction

Once the plasmid was successfully constructed and extracted, we performed the CFPS reactions for demonstrating the feasibility of in vitro sfGFP expression (Figure 9).

Before CFPS reaction, we initially established a standard curve for the conversion of "sfGFP (µg/mL)—Fluorescence (a.u.)" (Figure 10).

Subsequently, following the commonly used CFPS protocol^[6], we successfully produced sfGFP yielding 1051(±84) µg/mL, which achieved acceptable yield in this research area. Meanwhile, the green color of expressed sfGFP could be clearly observed under the bright field, also the green fluorescence could be detected and imaged by imager (Figure 11).

Conclusion

Taken together, this composite part was successfully constructed and characterized, demonstrating the feasibility of CFPS reaction for the in vitro production of proteins (e.g., sfGFP). Hence, this CFPS system was further utilized for the in vitro production of two antimicrobial peptides in our project, including Microcin H47 (BBa_K5133006) and Microcin M (BBa_K5133008).

DNA sequence (from 5' to 3')

atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataagtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtctt gaggggttttttgctgaaagccaattctga

Red font: T7 promoter (BBa_K5133000)

Green font: RBS (BBa_K5133001)

Blue font: sfGFP (BBa_K5133002)

Purple font: T7 terminator (BBa_K5133003)

References

[1] https://www.addgene.org/69496/

[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327

[3] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6, 343-345 (2009). doi: 10.1038/nmeth.1318

[4] Ba, F. et al. Rainbow screening: Chromoproteins enable visualized molecular cloning. Biotechnology Journal 19, 2400114 (2024). doi: 10.1002/biot.202400114

[5] Lin, C.H. et al. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay. PLoS One 6, e29101 (2011). doi: 10.1371/journal.pone.0029101

[6] Liu, W.Q. et al. Cell-free protein synthesis enables one-pot cascade biotransformation in an aqueous-organic biphasic system. Biotechnology and Bioengineering 117, 4001-4008 (2020). doi: 10.1002/bit.27541

Sequence and Features