Difference between revisions of "Part:BBa K5133007"
| (2 intermediate revisions by the same user not shown) | |||
| Line 56: | Line 56: | ||
</head> | </head> | ||
<body> | <body> | ||
| − | <img src="https://static.igem.wiki/teams/5133/bba-k5133007- | + | <img src="https://static.igem.wiki/teams/5133/bba-k5133007-22.jpg" class="resizable-img2"> |
</body> | </body> | ||
</html> | </html> | ||
| Line 71: | Line 71: | ||
==<b>Usages</b>== | ==<b>Usages</b>== | ||
| − | This part is used for the construction of composite part <bbpart>BBa_K5133008</bbpart> (Microcin M generator) to demonstrate the feasibility of <i>in vitro</i> antimicrobial peptide production by CFPS. | + | This part is used for the construction of composite part <bbpart>BBa_K5133008</bbpart> (Microcin M generator) to demonstrate the feasibility of <i>in vitro</i> antimicrobial peptide production by CFPS. <font color="blue"><font size=4><b>Please see the detailed experimental results in <bbpart>BBa_K5133008</bbpart>.</b></font></font> |
| Line 78: | Line 78: | ||
atgagaaaactatctgaaaatgaaataaaacaaatatctggaggtgacgggaatgacgggcaggcagaattaattgctattggttcacttgctggtacgtttattagcccgggatttggttctattgcaggggcttat | atgagaaaactatctgaaaatgaaataaaacaaatatctggaggtgacgggaatgacgggcaggcagaattaattgctattggttcacttgctggtacgtttattagcccgggatttggttctattgcaggggcttat | ||
| − | ataggtgataaagtacattcatgggcaacgactgcgacggttagtccctccatgtctccctcaggtataggattatcatcccagtttggatccggcagaggtacatcaagtgcctcttcgtctgcggggagtggaagt<font color="red">catcatcatcatcatcac</font>taa | + | ataggtgataaagtacattcatgggcaacgactgcgacggttagtccctccatgtctccctcaggtataggattatcatcccagtttggatccggcagaggtacatcaagtgcctcttcgtctgcggggagtggaagt |
| + | <font color="red">catcatcatcatcatcac</font>taa | ||
<font color="red">Red font: 6×His-Tag, for detecting the <i>in vitro</i> production of Microcin M by Western-Blot analysis</font> | <font color="red">Red font: 6×His-Tag, for detecting the <i>in vitro</i> production of Microcin M by Western-Blot analysis</font> | ||
| Line 89: | Line 90: | ||
[2] https://www.addgene.org/69496/ | [2] https://www.addgene.org/69496/ | ||
| + | |||
Latest revision as of 09:09, 27 July 2024
Microcin M
Group: GEC-China (iGEM 2024, team number: #5133)
Brief introduction
This basic part is derived from plasmid pFB398[1], including a DNA sequence for coding Microcin M, an antimicrobial peptide produced by probiotic E. coli Nissle 1917. By assembling with T7 promoter (BBa_K5133000), RBS (BBa_K5133001), and T7 terminator (BBa_K5133003) derived from plasmid pJL1[2], this part is used for the construction of composite part BBa_K5133008 to demonstrate the in vitro production of antimicrobial peptides by CFPS.
Design and characterization
The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133008 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), Microcin M (this part), and T7 terminator (BBa_K5133003) in Figure 2.
Usages
This part is used for the construction of composite part BBa_K5133008 (Microcin M generator) to demonstrate the feasibility of in vitro antimicrobial peptide production by CFPS. Please see the detailed experimental results in BBa_K5133008.
DNA sequence (from 5' to 3')
atgagaaaactatctgaaaatgaaataaaacaaatatctggaggtgacgggaatgacgggcaggcagaattaattgctattggttcacttgctggtacgtttattagcccgggatttggttctattgcaggggcttat ataggtgataaagtacattcatgggcaacgactgcgacggttagtccctccatgtctccctcaggtataggattatcatcccagtttggatccggcagaggtacatcaagtgcctcttcgtctgcggggagtggaagt catcatcatcatcatcactaa
Red font: 6×His-Tag, for detecting the in vitro production of Microcin M by Western-Blot analysis
References
[1] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327
[2] https://www.addgene.org/69496/
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 226
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]