Difference between revisions of "Part:BBa K5133003"
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
<partinfo>BBa_K5133002 short</partinfo>
+
<partinfo>BBa_K5133003 short</partinfo>
  
 
Group: <b>GEC-China (iGEM 2024, team number: #5133)</b>
 
Group: <b>GEC-China (iGEM 2024, team number: #5133)</b>
Line 8: Line 8:
 
==<b>Brief introduction</b>==
 
==<b>Brief introduction</b>==
  
−
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including an DNA sequence for coding sfGFP (superfolder green fluorescent protein). The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> to demonstrate the feasibility of CFPS in our project.
+
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a conserved T7 terminator as <b>5'-ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg-3'</b>. The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
  
  
 
==<b>Design and characterization</b>==
 
==<b>Design and characterization</b>==
  
−
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>). (<b>Figure 2</b>).
+
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. Result of Sanger sequencing shows the correct construction of this part (<b>Figure 2</b>).
  
  
Line 30: Line 30:
 
</head>
 
</head>
 
<body>
 
<body>
−
     <img src="https://static.igem.wiki/teams/5133/bba-k5133002-1.jpg"  class="resizable-img1">
+
     <img src="https://static.igem.wiki/teams/5133/bba-k5133003-1.jpg"  class="resizable-img1">
 
</body>
 
</body>
 
</html>
 
</html>
Line 55: Line 55:
 
</head>
 
</head>
 
<body>
 
<body>
−
     <img src="https://static.igem.wiki/teams/5133/bba-k5133002-2.jpg"  class="resizable-img2">
+
     <img src="https://static.igem.wiki/teams/5133/bba-k5133003-2.jpg"  class="resizable-img2">
 
</body>
 
</body>
 
</html>
 
</html>
Line 70: Line 70:
 
==<b>Usages</b>==
 
==<b>Usages</b>==
  
−
This part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> (sfGFP generator) to demonstrate the feasibility of CFPS in our project.
+
This part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
  
  
Line 76: Line 76:
 
==<b>DNA sequence (from 5' to 3')</b>==
 
==<b>DNA sequence (from 5' to 3')</b>==
  
−
atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt
+
gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataa<font color="red">ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg</font>ctgaaagccaattctga
−
atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat
+
−
gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc
+
−
cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag
+
−
aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt
+
−
attacg<font color="red">tggagccatccgcagttcgaaaaa</font>taa
+
  
−
<font color="red">Red font: Strep-Tag II, from pJL1<sup>[1]</sup></font>
+
<font color="red">Red font: T7 terminator</font>
  
  
Line 93: Line 88:
  
 
[2] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 
[2] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 +
  
  

Latest revision as of 07:54, 27 July 2024


T7 terminator (from plasmid pJL1)

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a conserved T7 terminator as 5'-ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg-3'. The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2]. Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Result of Sanger sequencing shows the correct construction of this part (Figure 2).


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


DNA sequence (from 5' to 3')

gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga

Red font: T7 terminator


References

[1] https://www.addgene.org/69496/


[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]