Difference between revisions of "Part:BBa K5133003"
 
(2 intermediate revisions by the same user not shown)
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
{|width='80%'
 
−
|-
 
−
|width=35% valign='top'|
 
−
[[Image:Terminator.png]]
 
−
<partinfo>BBa_K5133003 parameters</partinfo>
 
−
| width=50% valign='top' style='border: 1px solid black'|
 
 
<partinfo>BBa_K5133003 short</partinfo>
 
<partinfo>BBa_K5133003 short</partinfo>
−
* TBD
 
  
−
|}
+
Group: <b>GEC-China (iGEM 2024, team number: #5133)</b>
  
−
'''Secondary Structure'''
 
  
−
[[Image:Mfold-K5133003-1.png]]
+
==<b>Brief introduction</b>==
 +
 
 +
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a conserved T7 terminator as <b>5'-ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg-3'</b>. The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
 +
 
 +
 
 +
==<b>Design and characterization</b>==
 +
 
 +
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. Result of Sanger sequencing shows the correct construction of this part (<b>Figure 2</b>).
 +
 
 +
 
 +
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img1 {
 +
            max-width: 60%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133003-1.jpg"  class="resizable-img1">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 1. Schematic design of this part, generated by SnapGene.</b></center>
 +
 
 +
 
 +
 
 +
 
 +
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img2 {
 +
            max-width: 90%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133003-2.jpg"  class="resizable-img2">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.</b></center>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
==<b>Usages</b>==
 +
 
 +
This part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
 +
 
 +
 
 +
 
 +
==<b>DNA sequence (from 5' to 3')</b>==
 +
 
 +
gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataa<font color="red">ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg</font>ctgaaagccaattctga
 +
 
 +
<font color="red">Red font: T7 terminator</font>
 +
 
 +
 
 +
 
 +
==<b>References</b>==
 +
 
 +
[1] https://www.addgene.org/69496/
 +
 
 +
 
 +
[2] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
  
−
<hr>
 
−
'''Measurement'''
 
−
* [https://openwetware.org/wiki/Cconboy:Terminator_Characterization/Results How these parts were measured]
 
  
  

Latest revision as of 07:54, 27 July 2024


T7 terminator (from plasmid pJL1)

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a conserved T7 terminator as 5'-ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg-3'. The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2]. Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Result of Sanger sequencing shows the correct construction of this part (Figure 2).


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


DNA sequence (from 5' to 3')

gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga

Red font: T7 terminator


References

[1] https://www.addgene.org/69496/


[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]