Difference between revisions of "Part:BBa K5133002"
 
(2 intermediate revisions by the same user not shown)
Line 8: Line 8:
 
==<b>Brief introduction</b>==
 
==<b>Brief introduction</b>==
  
−
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including an DNA sequence for coding sfGFP (superfolder green fluorescent protein). The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> to demonstrate the feasibility of CFPS in our project.
+
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a DNA sequence for coding sfGFP (superfolder green fluorescent protein). The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> to demonstrate the feasibility of CFPS in our project.
  
  
 
==<b>Design and characterization</b>==
 
==<b>Design and characterization</b>==
  
−
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>). (<b>Figure 2</b>).
+
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>) in <b>Figure 2</b>.
  
  
Line 70: Line 70:
 
==<b>Usages</b>==
 
==<b>Usages</b>==
  
−
This part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> (sfGFP generator) to demonstrate the feasibility of CFPS in our project.
+
This part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> (sfGFP generator) to demonstrate the feasibility of CFPS in our project. <font color="blue"><font size=4><b>Please see the detailed experimental results in <bbpart>BBa_K5133004</bbpart>.</b></font></font>
  
  

Latest revision as of 09:05, 27 July 2024


sfGFP (from plasmid pJL1)

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a DNA sequence for coding sfGFP (superfolder green fluorescent protein). The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2]. Hence, this part is used for the construction of composite part BBa_K5133004 to demonstrate the feasibility of CFPS in our project.


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133004 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), sfGFP (this part), and T7 terminator (BBa_K5133003) in Figure 2.


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project. Please see the detailed experimental results in BBa_K5133004.


DNA sequence (from 5' to 3')

atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa

Red font: Strep-Tag II, from pJL1[1]


References

[1] https://www.addgene.org/69496/


[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]