Difference between revisions of "Part:BBa K5133000"
 
(5 intermediate revisions by the same user not shown)
Line 8: Line 8:
 
==<b>Brief introduction</b>==
 
==<b>Brief introduction</b>==
  
−
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a conserved DNA sequence of T7 promoter as <b>5'-taatacgactcactatagggaga-3'</b><sup>[2]</sup>. The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS). Hence, this part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
+
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a conserved DNA sequence of T7 promoter as <b>5'-taatacgactcactatagggaga-3'</b><sup>[2]</sup>. The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[3]</sup>. Hence, this part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project.
  
  
Line 36: Line 36:
  
  
−
<center><b>Figure 1. Design of basic part BBa_K5133000, generated by SnapGene.</b></center>
+
<center><b>Figure 1. Schematic design of this part, generated by SnapGene.</b></center>
  
  
Line 49: Line 49:
 
     <style>
 
     <style>
 
         .resizable-img2 {
 
         .resizable-img2 {
−
             max-width: 80%;
+
             max-width: 90%;
 
             height: auto;
 
             height: auto;
 
         }
 
         }
Line 61: Line 61:
  
  
−
<center><b>Figure 2. Validation the DNA sequence of BBa_K5133000 by Sanger sequencing, generated by SnapGene.</b></center>
+
<center><b>Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.</b></center>
  
  
Line 86: Line 86:
  
 
[2] Conrad, T. et al. Maximizing transcription of nucleic acids with efficient T7 promoters. <b>Communications Biology</b> 3, 439 (2020). doi: 10.1038/s42003-020-01167-x
 
[2] Conrad, T. et al. Maximizing transcription of nucleic acids with efficient T7 promoters. <b>Communications Biology</b> 3, 439 (2020). doi: 10.1038/s42003-020-01167-x
 +
 +
[3] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 +
  
  

Latest revision as of 06:22, 27 July 2024


T7 promoter (from plasmid pJL1)

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a conserved DNA sequence of T7 promoter as 5'-taatacgactcactatagggaga-3'[2]. The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[3]. Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Result of Sanger sequencing shows the correct construction of this part (Figure 2).


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.


DNA sequence (from 5' to 3')

atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt

Red font: conserved T7 promoter


References

[1] https://www.addgene.org/69496/

[2] Conrad, T. et al. Maximizing transcription of nucleic acids with efficient T7 promoters. Communications Biology 3, 439 (2020). doi: 10.1038/s42003-020-01167-x

[3] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 51
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 51
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 51
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 32