Difference between revisions of "Part:BBa K4765129"

Latest revision as of 15:24, 12 October 2023

stem-loop test

Introduction

In synthetic biology, it's common to integrate multiple heterologous genes into genetic circuits. Conventional approaches often utilize a polycistron system, where several genes are regulated under a single promoter. However, this can lead to reduced expression of downstream genes^[1].

In ribozyme-assisted polycistronic co-expression system (pRAP)^[2], the RNA sequence of ribozyme between coding sequences (CDSs) can conduct self-cleavage and convert polycistron into mono-cistrons in vivo. Self-interaction of the polycistron can be avoided and each mono-cistron can initiate translation with efficiency.

Figure 1. Principle of pRAP system. Ribozyme can conduct self-cleavage and covert polycistron into mono-cistrons, so that mono-cistrons can initiate translation with efficiency

In the pRAP system, stem-loop is a key regulatory element that affects protein concentration by regulating the rate of mRNA degradation ^[3]. By regulating the intensity of stem-loop, we can control the expression of proteins.

This year, we developed a quantitive pRAP system design software, and we also construct this composite part BBa_K4765129 (stem-loop test) to verify that we can control protein expression by changing stem-loop.

This composite includes T7 promoter, lac promoter, stayGold, Twister P1 (self-cleaving ribozyme), mScarlet, and T7 terminator, which is a stem-loop-deleted version of BBa_K4765120. We inserted different stem-loops between stayGold and Twister P1, and compared the red-green fluorescence intensity ratio to assess the stem-loop's ability to prevent mRNA degradation.

Figure 2. Biobricks in BBa_K4765129. BBa_K765129 includes promoter, stayGold, Twister P1 (self-cleaving ribozyme), mScarlet, and terminator.

Usage and Biology

Using our [http://54.169.242.254:5000/ software], we designed and tested different stem-loops' ability to prevent mRNA degradation, using this composite part.
nsl: no stem-loop
liu2023: natural occurred, described previously
new2/6/10 & old6/10: stem-loops designed by our software with different free energy change of reaction

nsl:     5-AAACACCCACCACAAUUUCCACCGUUU UUUGU-3
liu2023: 5-AAACACCCACCACAAUUUCCACCGUUU CCCGACGCUUCGGCGUCGGG UUUGU-3
new2:    5-AAACACCCACCACAAUUUCCACCGUUU CCCCGUCGGCUGCU UUUGU-3
new6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
new10:   5-AAACACCCACCACAAUUUCCACCGUUU ACUGGGGGGAUCGAGGUCUUU UUUGU-3
old6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
old10:   5-AAACACCCACCACAAUUUCCACCGUUU GGCGGCGCUACAGCGUCGU UUUGU-3

Characterization

Sequencing Map

Figure 3. Sequencing result of nsl (no stem-loop before Twister ribozyme cleavage site). Sanger sequencing verified that we have removed the stem-loop before ribozyme sequence, from BBa_K4765120. We also construct plasmids with stem-loop new2, new6, new10, old6, old10, all of which were designed by our Software RAP, and fully characterized using functional assays.

Microplate Reader Assay

1. Bacterial Culture: Following plasmid transformation and plating, use pipette tip to select monoclonal colony and culture for 24 hrs in a 96-well plate within incubator with gentle aggitation set at 37℃.
2. Sample Preparation: Transfer 25 μL of the bacterial culture from each well into another 96-well plate and dilute them with 75 μL of PBS.
3. Fluorescence Measurement: Use the microplate reader to measure GFP/RFP fluorescence. Set the excitation wavelength at 485/540 nm and the emmison wavelength at 528/620 nm.

Figure 4. The bottom view of the 96 well plate of bacterial overnight cultures. Some wells are very red, comparing with surrounding, suggest high leaky expression from T7 promoter.

Experimental Results

Our experimental findings unveiled a clear connection: as the change in free energy (ΔG) within the reaction decreases, mRNA stability increases, resulting in a higher GFP/RFP ratio. In summary, designing stem-loops with lower ΔG values enhances their ability to shield mRNA from degradation.

Figure 5. The relationship between the free enegy of stem-loop and GFP/OD and RFP/OD. Bacteria were cultured without IPTG, both GFP and RFP signal were driven by the T7 leaky promoter. In cells with higher leaky, stronger RFP/OD were observed. RFP signal is from the mScarlet CDS before T7 terminator, which uses the stem-loop structure formed by the terminator, and is most stable. We suggest to put the CDS needed most at the last position in pRAP system.

Figure 6. The relationship between the free enegy of stem-loop and mRNA degradation rate.

Summary

In conclusion, this composite part represents a novel strategy to employ 3' stem-loops for regulating mRNA stability and targeted protein levels, especially during polycistronic experssion.

The stem-loop sequence is at the end of coding sequence. It is a better strategy to regulate the protein expression level than changing 5' RBS (ribosome-binding site), which has high likelihood to be interfered with the coding sequence (CDS). This potential interference is CDS dependent. Thus for RBS, people could only phrase strong vs. weak RBS for different CDS. Our synthetic stem-loop sequences, are far away from CDS, and behavior as predicted, even when T7 leaky promoter drives different amount of mRNA transcription.

It is known that 3' sequence after the coding sequence affects mRNA stability. However, it is the first attempt to design synthetic stem-loop sequences with goals to regulate protein expression. Beyond promoter regulation or RBS regulation, we provides a new possibility to systematically regulate protein expression level, which strength could be faithfully predicted using simple equation, and ready available through our Software RAP. The composite part present here, provides opportunity to examine various natural occurring stem-loops sequences from sequences databases, and could be a useful tool to uncover novel RNA regulation mechanisms.

Sequence and Features

Reference

1. ↑ Kim, K.-J., Kim, H.-E., Lee, K.-H., Han, W., Yi, M.-J., Jeong, J., & Oh, B.-H. (2004). Two-promoter vector is highly efficient for overproduction of protein complexes. Protein Science: A Publication of the Protein Society, 13(6), 1698–1703. https://doi.org/10.1110/ps.04644504
2. ↑ Liu, Y., Wu, Z., Wu, D., Gao, N., & Lin, J. (2022). Reconstitution of Multi-Protein Complexes through Ribozyme-Assisted Polycistronic Co-Expression. ACS Synthetic Biology, 12(1), 136–143. https://doi.org/10.1021/acssynbio.2c00416
3. ↑ Newbury, S. F., Smith, N. H., & Higgins, C. F. (1987). Differential mRNA stability controls relative gene expression within a polycistronic operon. Cell, 51(6), 1131–1143. https://doi.org/10.1016/0092-8674(87)90599-x