Difference between revisions of "Part:BBa K3132000"
 
(7 intermediate revisions by 2 users not shown)
Line 4: Line 4:
  
 
This part is transformed from the part: Gal4-KRAB(<partinfo>BBa_K2446037</partinfo>) of Igem17_Fudan. To turn this TF into an activating one, we replaced the KRAB domain with a VP64. And this approach successfully reversed its effect as we had expected. Gal4-VP64 containing three core domains from N-terminal to C-terminal: GAL4 DNA binding domain, nuclear location sequence and VP64 transcription regulating domain. And a (G4S) linker was added between DBD and NLS for providing region flexibility. GAL4DBD enable binding to specific DNA sequences, so that we can use Gal4-VP64 as a specific transcription factors to activate the expression of our downstream synthetic promoter elements and minimal CMV.
 
This part is transformed from the part: Gal4-KRAB(<partinfo>BBa_K2446037</partinfo>) of Igem17_Fudan. To turn this TF into an activating one, we replaced the KRAB domain with a VP64. And this approach successfully reversed its effect as we had expected. Gal4-VP64 containing three core domains from N-terminal to C-terminal: GAL4 DNA binding domain, nuclear location sequence and VP64 transcription regulating domain. And a (G4S) linker was added between DBD and NLS for providing region flexibility. GAL4DBD enable binding to specific DNA sequences, so that we can use Gal4-VP64 as a specific transcription factors to activate the expression of our downstream synthetic promoter elements and minimal CMV.
−
 
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
  
Line 13: Line 11:
  
  
−
<!-- Uncomment this to enable Functional Parameter display
 
−
===Functional Parameters===
 
−
<partinfo>BBa_K3132000 parameters</partinfo>
 
−
<!-- -->
 
  
 
==Contribution==
 
==Contribution==
−
Group: Valencia_UPV iGEM 2018
+
Team: CSU-CHINA 2023
 
<br>
 
<br>
−
Author: Adrián Requena Gutiérrez, Carolina Ropero
+
__NOTOC__
 +
<partinfo>BBa_K4585012 short</partinfo>
 +
 
 +
The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid (<partinfo>BBa_K4585012</partinfo>), which could express GAL4-VP64, was used for Luciferase detection experiment. GAL4 is a protein that can find and bind UAS (upstream activation sequence). VP64 is a transcription factor that, when used in combination with GAL4, can activate UAS and initiate the expression of downstream genes.
 +
<html>
 +
 
 +
<head>
 +
           
 +
</head>
 +
       
 +
<body>
 +
<h2 class="pageContent-main__title">
 +
                <!--put tile here, <h2>title</h2>, class="pageContent-main__title" means it is the main title-->
 +
                pcDNA3.1(+)-3×HA-GAL4-VP64-NLS
 +
            </h2>
 +
            <div class="pageContent-main__textBox">
 +
                <!--all the content must included in this div-->
 +
                <p>The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid was obtained through homologous recombination of the VP64 homologous recombination insert (BBa_K4585002) with pcDNA3.1(+)-3×HA-GAL4-VP64-NLS linearized vector (BBa_K4585006).  The homologous recombination plasmid product was identified as the target product by sequencing and enzyme cutting and agarose gel electrophoresis.
 +
                </p>
 +
                <!--put text here, <p>content</p>-->
 +
            </div>
 +
            <h2 class="pageContent-main__title pageContent-main__subtitle">
 +
                <!--class="pageContent-main__title" means it is the sub title-->
 +
                1 Pattern Diagram
 +
            </h2>
 +
            <div class="pageContent-main__textBox">
 +
                <!--all the content must included in this div-->
 +
                <p style="text-align: center;">
 +
                    <img width="400px" src="https://static.igem.wiki/teams/4585/wiki/the-model-diagram-of-pcdna3-1-3-ha-gal4-vp64-nls.png"></p>
 +
                <br />
 +
                <!--put image's url here-->
 +
                <p style="width: 80%;text-align:center;font-size: .9rem; margin: -1rem auto 1rem auto; color: #888;">Fig.1 The model diagram of pcDNA3.1(+)-3×HA-GAL4-VP64-NLS</p>
 +
            </div>
 +
            <h2 class="pageContent-main__title pageContent-main__subtitle">
 +
                <!--class="pageContent-main__title" means it is the sub title-->
 +
                2 Experiment
 +
            </h2>
 +
            <h2 class="pageContent-main__title pageContent-main__subtitle">
 +
                <!--class="pageContent-main__title" means it is the sub title-->
 +
                2.1 Method
 +
            </h2>
 +
            <div class="pageContent-main__textBox">
 +
                <!--all the content must included in this div-->
 +
                <p>The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid could express GAL4-VP64, thereby activating 9×UAS, which could activate the expression of its downstream gene, GAL4-KRAB or Luciferase.
 +
                </p>
 +
                <!--put text here, <p>content</p>-->
 +
            </div>
 +
            <h2 class="pageContent-main__title pageContent-main__subtitle">
 +
                <!--class="pageContent-main__title" means it is the sub title-->
 +
                2.2 Results
 +
            </h2>
 +
            <div class="pageContent-main__textBox">
 +
                <!--all the content must included in this div-->
 +
                <p>HEK 293T cells were transiently transfected with GAL-VP64 and GAL-KRAB plasmids, and an appropriate amount of Luciferase plasmids were transfected to simulate GnRH. The experiment showed that the GAL-VP64 plasmid could initiate the expression of GAL4-KRAB and Luciferase.
 +
                </p>
 +
                <p style="text-align: center;">
 +
                    <img width="400px" src="https://static.igem.wiki/teams/4585/wiki/biofluorescence-intensity-when-gal4-vp64-gal4-krab-400-ng.png"></p>
 +
<br />
 +
                <!--put image's url here-->
 +
                <p style="width: 80%;text-align:center;font-size: .9rem; margin: -1rem auto 1rem auto; color: #888;">Fig 2. Bioluminescence intensity when GAL4-VP64=GAL4-KRAB=400 ng</p>
 +
            </div>
 +
            <h2 class="pageContent-main__title pageContent-main__subtitle">
 +
                <!--class="pageContent-main__title" means it is the sub title-->
 +
                3 Caution
 +
            </h2>
 +
            <div class="pageContent-main__textBox">
 +
                <!--all the content must included in this div-->
 +
                <p>After sequencing and ensuring the sequence was correct, we applied it to the experiments. Store at 4℃.
 +
                </p>
 +
            </div>
 +
</body>
 +
</html>
 +
<br />
 +
==Contribution==
 +
Team: Duke iGEM 2024
 +
 
 +
<html>
 +
<p>Duke iGEM used Gal4-VP64 as a positive control in the testing of the Gal4 Upstream Activating Sequence (UAS). We cloned the Gal4-VP64 into a pcDNA5 backbone with the following primers: </p>
 +
 
 +
<p>Gal4-VP64_fwd: 5’ - gagctcggatcccgactagt<b>atgaagctgctgagcagc</b> - 3’</p>
 +
 
 +
<p>Gal4-VP64_rev: 5’ - ctctagactcgagcggccgc<b>tcatgatccgagcatgtc</b> - 3’</p>
 
<br>
 
<br>
−
Summary: We have adapted the part to be able to assemble transcriptional units with the Golden Gate method and we have done the characterization of this RBS.
+
<p>pcDNA5_fwd: 5’ - GCGGCCGCTCGAGTCTAG - 3’</p>
−
<br>
+
 
−
Documentation:
+
<p>pcDNA5_rev: 5’ - ACTAGTCGGGATCCGAGCTC - 3’</p>
 
<br>
 
<br>
−
BBa_K2656011 is the RBS [https://parts.igem.org/Part:BBa_B0034 B0034] standardized into the Golden Braid assembly method. It also includes the BioBrick equivalent scar in the 3' extreme, so the insertion of this supplementary bases ensure correct spacing for the CDS expression when assembled into a TU.
 
  
−
Characterization of the this part was performed with the transcriptional unit [https://parts.igem.org/Part:BBa_K2656101 BBa_K2656101 ], which was used in a comparative RBS expression experiment with composite parts [https://parts.igem.org/Part:BBa_K2656101 BBa_K2656101] and [https://parts.igem.org/Part:BBa_K2656102 BBa_K2656102].  
+
<p>In our experiments, Gal4-VP64 was designed to be constitutively expressed under the CMV promoter. To validate the part's ability to activate the Gal4 UAS site, we co-transfected pcDNA5-Gal4-VP64 with Gal4 UAS-BFP reporter system into HEK293T cells. The cells were incubated for 48 hours and analyzed using flow cytometry. The results showed an increase in the median BFP fluorescence compared to the negative control (<b>Figure 1</b>), which expressed only the Gal4 UAS-BFP reporter system. The outcome of this experiment successfully validated our approach to use the constitutively active Gal4-VP64 as a positive control in various tests involving the Gal4 UAS site. </p>
−
They all were assembled in a Golden Braid alpha1 plasmid using the same promoter, CDS and terminator.
+
<div style="text-align: center;">
 +
<img src="https://static.igem.wiki/teams/5198/registry/bba-k3132000-fig1.webp" width="400">
 +
</div>
 +
<p><b>Figure 1.</b> Representative histogram of median BFP fluorescence in HEK293T cells co-expressing Gal4-VP64 activator and Gal4 UAS-BFP reporter system. The negative control (NC) cells were transfected with only the Gal4 UAS-BFP reporter system and show lower median fluorescence.</p>
  
−
By using this [http://2018.igem.org/Team:Valencia_UPV/Experiments#exp_protocol experimental protocol], we have obtained the parameters to valide our [http://2018.igem.org/Team:Valencia_UPV/Modeling#models constitutive model]and rationale choose its [http://2018.igem.org/Team:Valencia_UPV/Modeling#optimization optimization values] based on each RBS tested.
+
<p>We implemented the Gal4-VP64 positive control in multiple experiments during the development of our ATLAS project. As an example, we investigated the activity of synNotch when exposed to a CD19+ Raji cell line (<b>Figure 2</b>). Thanks to the Gal4-VP64 control, we were able to conclude that our experiments were unsuccessful and further experimental improvements are needed.</p>
 +
<div style="text-align: center;">
 +
<img src="https://static.igem.wiki/teams/5198/registry/bba-k3132000-fig2.webp" width="400">
 +
</div>
 +
<p><b>Figure 2.</b> An example implementation of the Gal4-VP64 control in an experimental context. The histogram summarizes median BFP fluorescence in HEK293T cells co-transfected with FMC63 synNotch and Gal4 UAS-BFP reporter system. The effector cells were exposed to CD19+ Raji cell line in different E:T ratios (1:10, 1:1, 10:1) 24 hrs post-transfection. The experimental conditions overlap with the negative control (-Raji) and show decreased activation compared to the Gal4-VP64 control. </p>
 +
</html>

Latest revision as of 22:34, 1 October 2024


Gal4-VP64

This part is transformed from the part: Gal4-KRAB(BBa_K2446037) of Igem17_Fudan. To turn this TF into an activating one, we replaced the KRAB domain with a VP64. And this approach successfully reversed its effect as we had expected. Gal4-VP64 containing three core domains from N-terminal to C-terminal: GAL4 DNA binding domain, nuclear location sequence and VP64 transcription regulating domain. And a (G4S) linker was added between DBD and NLS for providing region flexibility. GAL4DBD enable binding to specific DNA sequences, so that we can use Gal4-VP64 as a specific transcription factors to activate the expression of our downstream synthetic promoter elements and minimal CMV.

Usage and Biology

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 41
    Illegal NgoMIV site found at 176
  • 1000
    COMPATIBLE WITH RFC[1000]


Contribution

Team: CSU-CHINA 2023

pcDNA3.1(+)-3XHA-GAL4-VP64-NLS

The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid (BBa_K4585012), which could express GAL4-VP64, was used for Luciferase detection experiment. GAL4 is a protein that can find and bind UAS (upstream activation sequence). VP64 is a transcription factor that, when used in combination with GAL4, can activate UAS and initiate the expression of downstream genes.

pcDNA3.1(+)-3×HA-GAL4-VP64-NLS

The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid was obtained through homologous recombination of the VP64 homologous recombination insert (BBa_K4585002) with pcDNA3.1(+)-3×HA-GAL4-VP64-NLS linearized vector (BBa_K4585006). The homologous recombination plasmid product was identified as the target product by sequencing and enzyme cutting and agarose gel electrophoresis.

1 Pattern Diagram


Fig.1 The model diagram of pcDNA3.1(+)-3×HA-GAL4-VP64-NLS

2 Experiment

2.1 Method

The pcDNA3.1(+)-3×HA-GAL4-VP64-NLS plasmid could express GAL4-VP64, thereby activating 9×UAS, which could activate the expression of its downstream gene, GAL4-KRAB or Luciferase.

2.2 Results

HEK 293T cells were transiently transfected with GAL-VP64 and GAL-KRAB plasmids, and an appropriate amount of Luciferase plasmids were transfected to simulate GnRH. The experiment showed that the GAL-VP64 plasmid could initiate the expression of GAL4-KRAB and Luciferase.


Fig 2. Bioluminescence intensity when GAL4-VP64=GAL4-KRAB=400 ng

3 Caution

After sequencing and ensuring the sequence was correct, we applied it to the experiments. Store at 4℃.


Contribution

Team: Duke iGEM 2024

Duke iGEM used Gal4-VP64 as a positive control in the testing of the Gal4 Upstream Activating Sequence (UAS). We cloned the Gal4-VP64 into a pcDNA5 backbone with the following primers:

Gal4-VP64_fwd: 5’ - gagctcggatcccgactagtatgaagctgctgagcagc - 3’

Gal4-VP64_rev: 5’ - ctctagactcgagcggccgctcatgatccgagcatgtc - 3’


pcDNA5_fwd: 5’ - GCGGCCGCTCGAGTCTAG - 3’

pcDNA5_rev: 5’ - ACTAGTCGGGATCCGAGCTC - 3’


In our experiments, Gal4-VP64 was designed to be constitutively expressed under the CMV promoter. To validate the part's ability to activate the Gal4 UAS site, we co-transfected pcDNA5-Gal4-VP64 with Gal4 UAS-BFP reporter system into HEK293T cells. The cells were incubated for 48 hours and analyzed using flow cytometry. The results showed an increase in the median BFP fluorescence compared to the negative control (Figure 1), which expressed only the Gal4 UAS-BFP reporter system. The outcome of this experiment successfully validated our approach to use the constitutively active Gal4-VP64 as a positive control in various tests involving the Gal4 UAS site.

Figure 1. Representative histogram of median BFP fluorescence in HEK293T cells co-expressing Gal4-VP64 activator and Gal4 UAS-BFP reporter system. The negative control (NC) cells were transfected with only the Gal4 UAS-BFP reporter system and show lower median fluorescence.

We implemented the Gal4-VP64 positive control in multiple experiments during the development of our ATLAS project. As an example, we investigated the activity of synNotch when exposed to a CD19+ Raji cell line (Figure 2). Thanks to the Gal4-VP64 control, we were able to conclude that our experiments were unsuccessful and further experimental improvements are needed.

Figure 2. An example implementation of the Gal4-VP64 control in an experimental context. The histogram summarizes median BFP fluorescence in HEK293T cells co-transfected with FMC63 synNotch and Gal4 UAS-BFP reporter system. The effector cells were exposed to CD19+ Raji cell line in different E:T ratios (1:10, 1:1, 10:1) 24 hrs post-transfection. The experimental conditions overlap with the negative control (-Raji) and show decreased activation compared to the Gal4-VP64 control.